New ! Biology MCQ Practise Tests

12th Standard Biology Study material & Free Online Practice Tests - View Model Question Papers with Solutions for Class 12 Session 2019 - 2020
TN Stateboard [ Chapter , Marks , Book Back, Creative & Term Based Questions Papers - Syllabus, Study Materials, MCQ's Practice Tests etc..]

Biology Question Papers

12th Standard English Medium Biology Reduced Syllabus Annual Exam Model Question Paper with Answer key - 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Identify the correct option to label the diagram Identify the structure
    1- Immature proglottids
    2 - Gravid proglottids
    3 - Scolex
    4 - Mature proglottids
    5 - Neck

  • 2)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375
  • 3)

    Semi-conservative model of replication was proved by _________

  • 4)

    Modern man belongs to which period?

  • 5)

    _________is used for recycling of PET plastics

12th Standard English Medium Biology Reduced Syllabus Annual Exam Model Question Paper - 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    ______ is a seasonal breeder.

  • 2)

    Identify the correct statements from the following

  • 3)

    Which is NOT a part of transcription unit?

  • 4)

    The Neanderthal man had the brain capacity of

  • 5)

    What gases are produced in anaerobic sludge digesters?

12th Standard English Medium Biology Reduced Syllabus Public Exam Model Question Paper with Answer key - 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Pick out the organism whose fertilization occurs internally

  • 2)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 3)

    _______is unique for DNA.

  • 4)

    The golden age of reptiles was

  • 5)

    Plants used for bio-diesel production________

12th Standard English Medium Biology Reduced Syllabus Public Exam Model Question Paper - 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which among the following animals exhibit ovoviviparity?

  • 2)

    The approach which does not give the defined action of contraceptive is

  • 3)

    Which of the following mRNA yields 6 amino acids after translation?

  • 4)

    A population will not exist in Hardy- Weinberg equilibrium if

  • 5)

    Yamuna Action Plan was a bilateral project signed between ________________

12th Standard English Medium Biology Reduced Syllabus Creative Five mark Question with Answer key - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Describe the regeneration process noticed in living organism.

  • 2)

    Describe the spermatogenesis with diagram.

  • 3)

    What are IUD's? Explain its way of functioning. Also describe their types.

  • 4)

    Explain in detail about Erythroblastosis foetalis.

  • 5)

    List the salient features of genetic code.

12th Standard English Medium Biology Reduced Syllabus Creative Three mark Question with Answer key - 2021(Public Exam) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Differentiate exogenous and endogenous budding.

  • 2)

    How does budding occurs is hydra?

  • 3)

    What is Incomplete parthenogenesis? Explain with example.

  • 4)

    What is the function of Sertoli cells?

  • 5)

    What are Braxter-Hick's contractions?

12th Standard English Medium Biology Reduced Syllabus Creative Two mark Question with Answer key - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Define regeneration mention the types.

  • 2)

    What is Placentation?

  • 3)

    In females a. oogonia forms a single ovum only. What is the significance of the oogonia undergoing meiosis I & II when in a male, each spematogonia forms 4 sperms .

  • 4)

    Name two sexually transmitted infections and their casual agent.

  • 5)

    Explain the inheritance pattern of V-linked genes with example

12th Standard English Medium Biology Reduced Syllabus Creative One mark Question with Answer key - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    During favourable conditions ______ shows multiple fission.

  • 2)

    Regeneration is not seen in ______

  • 3)

    ______ is a seasonal breeder.

  • 4)

    In honey bees, the unfertilized egg produces

  • 5)

    Fusion of morphologically and physiologically similar gametes is called ______

12th Standard English Medium Biology Reduced Syllabus Five mark Important Questions with Answer key - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Differentiate between the following:
    (a) Binary fission in amoeba and multiple fission in Plasmodium
    (b) Budding in yeast and budding in Hydra
    (c) Regeneration in lizard and Planaria

  • 2)

    The following is the illustration of the sequence of ovarian events (a-i) in a human female.

    a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents.
    b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events.
    c) Explain the changes that occurs in the uterus simultaneously in anticipation.
    d) Write the difference between C and H.

  • 3)

    Amnicentesis, the foetal sex determination test, is banned in our country, Is it necessary? comment

  • 4)

    Comment on the methods of Eugenics.

  • 5)

    It is established that RNA is the first genetic material. Justify giving reasons.

12th Standard English Medium Biology Reduced Syllabus Five mark Important Questions - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    What is the difference between syngamy and fertilization?

  • 2)

    Explain the role of oxytocin and relaxin in parturition and lactation.

  • 3)

    The procedure of GIFT involves the transfer of female gametes into the fallopain tube, can gametes be transferred to the uterus to achieve the same result? Explain.

  • 4)

    Explain the inheritance of sex linked characters in human being.

  • 5)

    If the coding sequence in a transcription unit is written as follows:
    5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA

12th Standard English Medium Biology Reduced Syllabus Three mark Important Questions with Answer key - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Differentiate foeticide and infanticide

  • 2)

    Who disproved Lamarck’s Theory of acquired characters? How?

  • 3)

    What are DNA vaccines?

  • 4)

    Why do we find a decrease in biodiversity distribution, if we move from the tropics towards the poles?

  • 5)

    Write a brief note on Habitat fragmentation.

12th Standard English Medium Biology Reduced Syllabus Three mark Important Questions - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Give reasons for the following:
    (a) Some organisms like honey bees are called parthenogenetic animals
    (b) A male honey bee has 16 chromosomes where as its female has 32 chromosomes

  • 2)

    What is strobilation?

  • 3)

    Explain briefly on the nature of Ovovivipary.

  • 4)

    What is LH surge?

  • 5)

    Name the absorbents or materials used to manage menstruation.

12th Standard English Medium Biology Reduced Syllabus Two mark Important Questions with Answer key - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Name an organism where cell division is itself a mode of reproduction.

  • 2)

    What are exogenous buds?

  • 3)

    What is paedogenesis?

  • 4)

    Repeated fission is a type of multiple fission. Yes or No? Why?

  • 5)

    Name the types of cells found in seminiferous tubule.

12th Standard English Medium Biology Reduced Syllabus Two mark Important Questions - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    What is parthenogenesis? Give two examples from animals.

  • 2)

    Define hologamy.

  • 3)

    Why asexual reproduction is called as somatogenic reproduction?

  • 4)

    What is colostrum? Write its significance.

  • 5)

    Define fertilisation.

12th Standard English Medium Biology Reduced Syllabus One mark Important Questions with Answer key - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The foetal membrane that forms the basis of the umbilical cord is

  • 2)

    Find the wrongly matched pair

  • 3)

    Identify the correct statements from the following

  • 4)

    Haemophilia is more common in males because it is a

  • 5)

    Which of the following phenotypes in the progeny are possible from the parental combination AxB?

12th Standard English Medium Biology Reduced Syllabus One mark Important Questions - 2021(Public Exam ) - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The mode of reproduction in bacteria is by

  • 2)

    Multiple fission is seen in _______

  • 3)

    Paramecium and planaria show _____ types of division during asexual reproduction

  • 4)

    ______ refers to the fusion of small sized, morphologically different gametes.

  • 5)

    Which among the following animal is not a continuous breeder?

12th Standard Bio-Zoology English Medium Environmental Issues Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The Ozone Day is observed every year on September 16 as on this day in 1987 the ___________was signed for launching efforts to arrest the depletion of the fragile ozone layer in the stratosphere that prevents the harmful ultra-violet rays of the sun from reaching the earth. Fill the correct word in blank.

  • 2)

    SMOG is derived from :

  • 3)

    Excess of fluoride in drinking water causes:

  • 4)

    Incineration is the best method to dispose ____________

  • 5)

    The 2018 UN climate change conference was held in ___________

12th Standard Bio-Zoology English Medium Environmental Issues Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    With which of the following, the Agenda 21’ of Rio Summit, 1992 is related to?

  • 2)

    Which among the following awards instituted by the Government of India for individuals or communities from rural areas that have shown extraordinary courage and dedication in protecting Wildlife?

  • 3)

    Which among the following always decreases in a Food chain across tropic levels?

  • 4)

    In the E- waste generated by the Mobile Phones, which among the following metal is most abundant?

  • 5)

    Oil spills can lead to ________________

12th Standard Bio-Zoology English Medium Biodiversity and its Conservation Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Who introduced the term biodiversity?

  • 2)

    Which one of the following are at high risk extinction due to habitat destruction

  • 3)

    There are ________ mega biodiversity countries in the world

  • 4)

    The grizzled squirrel and lion tailed Macaque are endemic to _____________

  • 5)

    ___________ is a biographical gateway for much of India's flora and fauna.

12th Standard Bio-Zoology English Medium Biodiversity and its Conservation Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The Species-Area relationship was given by ___________

  • 2)

    ___________ is not a exotic species.

  • 3)

    Death of _____________ population is attributed to the medicine Diclofenac.

  • 4)

    The red data book is maintained by ____________

  • 5)

    Red list has _____________ categories.

12th Standard Bio-Zoology English Medium Organisms and Populations Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The interaction in nature, where one gets benefit on the expense of other is...

  • 2)

    Match the following and choose the correct combination from the options given below.

    Column I Column II
    A. Mutalism 1. Lion and deer
    B. Commensalism 2. Round worm and man
    C. Parasitism 3. Birds compete with squirrels for nuts
    D. Competition 4. Sea anemone on hermit crab
    E. Predation 5. Bernacles attached to Whales.


  • 3)

    The figure given below is a diagrammatic representation of response of organisms to abiotic factors. What do A, B and C represent respectively.

  • 4)

    Which of the following is correct for r-selected species

  • 5)

    Nuts are eaten by birds and squirrels. This is an example of an interaction called _____________

12th Standard Bio-Zoology English Medium Organisms and Populations Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following is an r-species

  • 2)

    Match the following and choose the correct combination from the options given below.

    Column I Column II
    A. Mutalism 1. Lion and deer
    B. Commensalism 2. Round worm and man
    C. Parasitism 3. Birds compete with squirrels for nuts
    D. Competition 4. Sea anemone on hermit crab
    E. Predation 5. Bernacles attached to Whales.


  • 3)

    Which of the following is correct for r-selected species

  • 4)

    Animals that can move from fresh water to sea called as______

  • 5)

    "Birds and mammals attain greater body size in colder regions than warmer regions." - Choose the correct option.

12th Standard Bio-Zoology English Medium Applications of Biotechnology Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which one of the following statements is true regarding DNA polymerase used in PCR?

  • 2)

    ELISA is mainly used for

  • 3)

    Vaccines that use components of a pathogenic organism rather than the whole organism are called

  • 4)

    Insulin was first isolated by_______

  • 5)

    Best and Banting isolated insulin from pancreatic islets of___________

12th Standard Bio-Zoology English Medium Applications of Biotechnology Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Dolly, the sheep was obtained by a technique known as

  • 2)

    Transgenic animals are those which have

  • 3)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

  • 4)

    Vaccines that use components of a pathogenic organism rather than the whole organism are called

  • 5)

    Interferons are produced using________

12th Standard Bio-Zoology English Medium Microbes in Human Welfare Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following bacteria is used extensively as a bio-pesticide?

  • 2)

    Which of the following is not involved in nitrogen fixation?

  • 3)

    The enzyme________is got from Aspergillus.

  • 4)

    ________is not used as a biofertilizer

  • 5)

    Biofertilizers are not involved in this process

12th Standard Bio-Zoology English Medium Microbes in Human Welfare Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following pair is correctly

  • 2)

    CO2 is not released during

  • 3)

    The purpose of biological treatment of waste water is to _______

  • 4)

    WorId Biofuel day is observed on_______

  • 5)

    Aspergillus niger helps to produce________

12th Standard Bio-Zoology English Medium Human Health and Diseases Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Cirrhosis of liver is caused by chronic intake of ______

  • 2)

    The sporozoite of the malarial parasite is present in ______

  • 3)

    Spread of cancerous cells to distant sites is termed as

  • 4)

    The site of infection for yersinia pestis is___________

  • 5)

    ___________is a pandemic disease

12th Standard Bio-Zoology English Medium Human Health and Diseases Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    A 30 year old woman has bleedy diarrhoea for the past 14 hours, which one of the following organisms is likely to cause this illness?

  • 2)

    Paratope is an

  • 3)

    Allergy involves

  • 4)

    Rigidity of the Jaw muscle is a symptom of__________

  • 5)

    The site of infection for yersinia pestis is___________

12th Standard Bio-Zoology English Medium Evolution Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

  • 2)

    Which of the following is the correct sequence of event with reference to the central dogma?

  • 3)

    Which of the following statements about DNA replication is not correct?

  • 4)

    Which of the following statements is not true about DNA replication in eukaryotes?

  • 5)

    An operon is a:

12th Standard Bio-Zoology English Medium Evolution Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Who published the book “Origin of species by Natural Selection” in 1859?

  • 2)

    Fossils are generally found in

  • 3)

    Evolutionary history of an organism is called

  • 4)

    Which period was called “Age of fishes”?

  • 5)

    The Neanderthal man had the brain capacity of

12th Standard Bio-Zoology English Medium Molecular Genetics Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    DNA and RNA are similar with respect to

  • 2)

    The first codon to be deciphered was __________ which codes for ________.

  • 3)

    When lactose is present in the culture medium:

  • 4)

    The term gene was coined by ________

  • 5)

    Griffith's experiments proved that _________.

12th Standard Bio-Zoology English Medium Molecular Genetics Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    DNA and RNA are similar with respect to

  • 2)

    A mRNA molecule is produced by

  • 3)

    Which of the following statements is not true about DNA replication in eukaryotes?

  • 4)

    The first codon to be deciphered was __________ which codes for ________.

  • 5)

    Chromosomes were first observed by ________.

12th Standard Bio-Zoology English Medium Principles Of Inheritance and Variation Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Haemophilia is more common in males because it is a

  • 2)

    What can be the blood group of offspring when both parents have AB blood group?

  • 3)

    If the childs blood group is ‘O’ and fathers blood group is ‘A’ and mother’s blood group is ‘B’ the genotype of the parents will be

  • 4)

    Mangolism is a genetic disorder which is caused by the presence of an extra chromosome number

  • 5)

    “Universal Donor” and “Universal Recipients” blood group are _____and_______respectively

12th Standard Bio-Zoology English Medium Principles Of Inheritance and Variation Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    ABO blood group in man is controlled by

  • 2)

    XO type of sex determination and XY type of sex determination are examples of

  • 3)

    Pataus’ syndrome is also referred to as

  • 4)

    The inheritance of blood group is determined by multiple alleles as discovered by _________.

  • 5)

    XX - XO type of sex determination is in ______.

12th Standard Bio-Zoology English Medium Reproductive Health Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    The approach which does not give the defined action of contraceptive is

  • 3)

    Read the given statements and select the correct option
    and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

  • 4)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 5)

    The family planning programme was initiated by India in _____

12th Standard Bio-Zoology English Medium Reproductive Health Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 3)

    Identify the correct statements from the following

  • 4)

    The family planning programme was initiated by India in _____

  • 5)

    The incubation period for _____ can be more than 10 years.

12th Standard Bio-Zoology English Medium Human Reproduction Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Colostrum is rich in

  • 2)

    The Androgen Binding Protein (ABP) is produced by

  • 3)

    A – Head of the sperm consists of acrosome and mitochondria.
    R – Acrosome contains spiral rows of mitochondria.

  • 4)

    ____ is not linked to male reproductive system.

  • 5)

    ______ cells nourish the sperms.

12th Standard Bio-Zoology English Medium Human Reproduction Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The mature sperms are stored in the

  • 2)

    The most important hormone in intiating and maintaining lactation after birth is

  • 3)

    Mammalian egg is

  • 4)

    The milk secreted by the mammary glands soon after child birth is called

  • 5)

    Colostrum is rich in

12th Standard Bio-Zoology English Medium Reproduction in Organisms Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason: Asexual reproduction involves only mitosis and no meiosis

  • 3)

    Transverse Binary fission is seen is ______

  • 4)

    Regeneration is not seen in ______

  • 5)

    If the entire organism behaves as a gamete the Phenomenon is called _____

12th Standard Bio-Zoology English Medium Reproduction in Organisms Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The mode of reproduction in bacteria is by

  • 2)

    Multiple fission is seen in _______

  • 3)

    During favourable conditions ______ shows multiple fission.

  • 4)

    Regeneration is not seen in ______

  • 5)

    Autogamy is seen in ______

12th Standard Bio-Botany English Medium Economically useful Plants Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Consider the following statements and choose the right option.
    i) Cereals are members of grass family.
    ii) Most of the food grains come from monocotyledon.

  • 2)

    Tectona grandis is coming under family

  • 3)

    New world species of cotton

  • 4)

    Assertion: Turmeric fights various kinds of cancer
    Reason: Curcumin is an anti-oxidant present in turmeric

  • 5)

    Find out the correctly matched pair.

12th Standard Bio-Botany English Medium Economically useful Plants Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Consider the following statements and choose the right option.
    i) Cereals are members of grass family.
    ii) Most of the food grains come from monocotyledon.

  • 2)

    Tamarindus indica is indigenous to

  • 3)

    New world species of cotton

  • 4)

    Observe the following statements and pick out the right option from the following:
    Statement I: The drug sources of Siddha include plants, animal parts, ores and minerals.
    Statement II: Minerals are used for preparing drugs with long shelf-life.

  • 5)

    The only cereal that has originated and domesticated from the New world.

12th Standard Bio-Botany English Medium Plant Breeding Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion: Genetic variation provides the raw material for selection
    Reason: Genetic variations are differences in genotypes of the individuals.

  • 2)

    The quickest method of plant breeding is

  • 3)

    Desired improved variety of economically useful crops are raised by

  • 4)

    Dwarfing gene of wheat is

  • 5)

    Crosses between the plants of the same variety are called

12th Standard Bio-Botany English Medium Plant Breeding Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Match Column I with Column II
    Column I Column II
    i) William S. Gaud I) Heterosis
    ii) Shull II) Mutation breeding
    iii) Cotton Mather III) Green revolution
    iv) Muller and Stadler IV) Natural hybridization

  • 2)

    Importing better varieties and plants from outside and acclimatising them to local environment is called

  • 3)

    Which one of the following crop varieties correct matches with its resistance to a disease?

  • 4)

    ________is the process of bringing a plant species under human control.

  • 5)

    Arbuscular mycorrhizae is a symbiotic association between ____________

12th Standard Bio-Botany English Medium Environmental Issues Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Depletion of which gas in the atmosphere can lead to an increased incidence of skin cancer?

  • 2)

    One green house gas contributes 14% of total global warming and another contributes 6%. These are respectively identified as

  • 3)

    Deforestation does not lead to

  • 4)

    The plants which are grown in silivpasture system are

  • 5)

    ___________ is not a method of waste water treatment.

12th Standard Bio-Botany English Medium Environmental Issues Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following would most likely help to slow down the greenhouse effect.

  • 2)

    With respect to Eichhornia
    Statement A: It drains off oxygen from water and is seen growing in standing water.
    Statement B: It is an indigenous species of our country.

  • 3)

    One green house gas contributes 14% of total global warming and another contributes 6%. These are respectively identified as

  • 4)

    The unit for measuring ozone thickness

  • 5)

    People’s movement for the protection of environment in Sirsi of Karnataka is

12th Standard Bio-Botany English Medium Ecosystem Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following is / are not a natural ecosystem?

  • 2)

    Which of the following ecosystem has the highest primary productivity?

  • 3)

    Which one is in descending order of a food chain

  • 4)

    Significance of food web is / are

  • 5)

    Which of the following is not a sedimentary cycle

12th Standard Bio-Botany English Medium Ecosystem Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which of the following is not a abiotic component of the ecosystem?

  • 2)

    Which of the following ecosystem has the highest primary productivity?

  • 3)

    The following diagram represents


  • 4)

    Which of the following are not regulating services of ecosystem services
    i) Genetic resources
    ii) Recreation and aesthetic values
    iii) Invasion resistance
    iv) Climatic regulation

  • 5)

    Identify the incorrect option among the following component sequence.

12th Standard Bio-Botany English Medium Principles Of Ecology Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Ecology is the study of an individual species is called
    i) Community ecology
    ii) Autecology
    iii) Species ecology
    iv) Synecology

  • 2)

    Read the given statements and select the correct option.
    i) Loamy soil is best suited for plant growth as it contains a mixture of silt, sand and clay.
    ii) The process of humification is slow in case of organic remains containing a large amount of lignin and cellulose.
    iii) Capillary water is the only water available to plant roots as it is present inside the micropores.
    iv) Leaves of shade plant have more total chlorophyll per reaction centre, low ratio of chl a and chl b are usually thinner leaves.

  • 3)

    In soil water available for plants is

  • 4)

    Read the following statements and fill up the blanks with correct option.
    i) Total soil water content in soil is called _________________
    ii) Soil water not available to plants is called _________________
    iii) Soil water available to plants is called

  • 5)

    Ophrys an orchid resembling the female of an insect so as to able to get pollinated is due to phenomenon of

12th Standard Bio-Botany English Medium Principles Of Ecology Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Arrange the correct sequence of ecological hierarchy starting from lower to higher level.

  • 2)

    A specific place in an ecosystem, where an organism lives and performs its functions is

  • 3)

    Read the given statements and select the correct option.
    i) Hydrophytes possess aerenchyma to support themselves in water.
    ii) Seeds of Viscum are positively photoblastic as they germinate only in presence of light.
    iii) Hygroscopic water is the only soil water available to roots of plant growing in soil as it is present inside the micropores.
    iv) High temperature reduces use of water and solute absorption by roots

  • 4)

    Which of the given plant produces cardiac glycosides?

  • 5)

    Read the given statements and select the correct option.
    i) Loamy soil is best suited for plant growth as it contains a mixture of silt, sand and clay.
    ii) The process of humification is slow in case of organic remains containing a large amount of lignin and cellulose.
    iii) Capillary water is the only water available to plant roots as it is present inside the micropores.
    iv) Leaves of shade plant have more total chlorophyll per reaction centre, low ratio of chl a and chl b are usually thinner leaves.

12th Standard Bio-Botany English Medium Plant Tissue Culture Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The time duration for sterilization process by using autoclave is ______ minutes and the temperature is _______

  • 2)

    Which of the following statement is correct

  • 3)

    Select the incorrect statement from given statement

  • 4)

    Virus free plants are developed from

  • 5)

    The prevention of large scale loss of biological interity

12th Standard Bio-Botany English Medium Plant Tissue Culture Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Virus free plants are developed from

  • 2)

    Cryopreservation means it is a process to preserve plant cells, tissues or organs

  • 3)

    Identify the group of scientists who developed the intergenic hybrid - the pomato.

  • 4)

    The production of secondary metabolites require the use of _________.

  • 5)

    Protoplast are the cells devoid of ___________

12th Standard Bio-Botany English Medium principles and processes of Bio-technology Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Plasmids are

  • 2)

    Consider the following statements:
    I. Recombinant DNA technology is popularly known as genetic engineering is a stream of biotechnology which deals with the manipulation of genetic materials by man invitro
    II. pBR322 is the first artificial cloning vector developed in 1977 by Boliver and Rodriguez from E.coli plasmid
    III. Restriction enzymes belongs to a classof enzymes called nucleases.
    C hoose the correct option regarding above statements

  • 3)

    The process of recombinant DNA technology has the following steps
    I. amplication of the gene
    II. Insertion of recombinant DNA into the host cells
    III. Cutting of DNA at specific location using restriction enzyme .
    IV. Isolation of genetic material (DNA) Pick out the correct sequence of step for recombinant DNA technology.

  • 4)

    Which one of the following palindromic base sequence in DNA can be easily cut at about the middle by some particular restriction enzymes?

  • 5)

    Which of the following one is used as a Biosensors?

12th Standard Bio-Botany English Medium principles and processes of Bio-technology Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Consider the following statements:
    I. Recombinant DNA technology is popularly known as genetic engineering is a stream of biotechnology which deals with the manipulation of genetic materials by man invitro
    II. pBR322 is the first artificial cloning vector developed in 1977 by Boliver and Rodriguez from E.coli plasmid
    III. Restriction enzymes belongs to a classof enzymes called nucleases.
    C hoose the correct option regarding above statements

  • 2)

    `In which techniques Ethidium Bromide is used?

  • 3)

    Assertion : Agrobacterium tumifaciens is popular in genetic engineering because this bacteriumis associated with the root nodules of all cereals and pulse crops
    Reason: A gene incorporated in the bacterial chromosomal genome gets atomatically transferred to the cross with which bacterium is associated.

  • 4)

    Which one of the following is not correct statement

  • 5)

    An analysis of chromosomal DNA using the southern hybridisation technique does not use

12th Standard Bio-Botany English Medium Chromosomal Basis of Inheritance Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    An allohexaploidy contains

  • 2)

    Match list I with list II

    List I list II
    A. A pair of chromosomes extra with diploid i) monosomy
    B. One chromosome extra to the diploid ii) tetrasomy
    C. One chromosome loses from diploid iii) trisomy
    D.Two individual chromosomes lose from diploid

    iv) double monosomy

  • 3)

    Accurate mapping of genes can be done by three point test cross because increases

  • 4)

    Genes G S L H are located on same chromosome. The recombination percentage is between L and G is 15%, S and L is 50%, H and S are 20%. The correct order of genes is

  • 5)

    If haploid number in a cell is 18. The double monosomic and trisomic number will be

12th Standard Bio-Botany English Medium Chromosomal Basis of Inheritance Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The A and B genes are 10 cM apart on a chromosome. If an AB/ab heterozygote is testcrossed to ab/ab, how many of each progeny class would you expect out of 100 total progeny?

  • 2)

    Accurate mapping of genes can be done by three point test cross because increases

  • 3)

    Due to incomplete linkage in maize, the ratio of parental and recombinants are

  • 4)

    How many map units separate two alleles A and B if the recombination frequency is 0.09?

  • 5)

    Which is not a feature of the chromosomal theory of inheritance?

12th Standard Bio-Botany English Medium Classical Genetics Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in

  • 2)

    The genotype of a plant showing the dominant phenotype can be determined

  • 3)

    The epistatic effect, in which the dihybrid cross 9:3:3:1 between AaBb Aabb is modified as

  • 4)

    In a test cross involving F1 dihybrid flies, more parental type offspring were produced than the recombination type offspring. This indicates

  • 5)

    The genes controlling the seven pea characters studied by Mendel are known to be located on how many different chromosomes?

12th Standard Bio-Botany English Medium Classical Genetics Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in

  • 2)

    Which one of the following is an example of polygenic inheritance?

  • 3)

    The genotype of a plant showing the dominant phenotype can be determined

  • 4)

    Fruit colour in squash is an example of

  • 5)

    Gene which suppresses other genes activity but does not lie on the same locus is called as

12th Standard Bio-Botany English Medium Asexual and Sexual Reproduction in plants Reduced Syllabus Important Questions With Answer Key 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Arrange the layers of anther wall from locus to periphery

  • 2)

    The genetic ability of a plant cell to produce the entire plant is said to be ________________

  • 3)

    Which is not a part of mature seed?

  • 4)

    Which of the following characters does not exist in Ornithophilous flowers?

  • 5)

    Generally, the pollen grains are liberated from another at ___________

12th Standard Bio-Botany English Medium Asexual and Sexual Reproduction in plants Reduced Syllabus Important Questions 2021 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Choose the correct statement from the following

  • 2)

    Match the following
    I) External fertilization i) pollen grain
    II) Androecium ii)anther wall
    III) Male gametophyte iii)algae
    IV) Primary parietal layer iv)stamens

  • 3)

    Transmitting tissue is found in

  • 4)

    Consider the following statement(s)
    i) In Protandrous flowers pistil matures earlier
    ii) In Protogynous flowers pistil matures earlier
    iii) Herkogamy is noticed in unisexual flowers
    iv) Distyly is present in Primula

  • 5)

    Cleavage polyembryony is noticed in _________________

12th Standard Biology English Medium Reduced Syllabus Model Question paper with Answer key - 2021 Part - 2 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment

  • 2)

    Budding is seen in ______

  • 3)

    A few statements with regard to sexual reproduction are given below:
    i. Sexual reproduction does not always require two individuals
    ii. Sexual reproduction generally involves gametic fusion
    iii. Meiosis never occurs during sexual reproduction
    iv. External fertilization is a rule during sexual reproduction
    Choose the correct statements from the options below:

  • 4)

    The male sex hormone testosterone is secreted from

  • 5)

    A – Ovulation is the release of ovum from the Graafian follicle.
    R – It occurs during the follicular phase of the menstrual cycle.

12th Standard Biology English Medium Reduced Syllabus Model Question paper with Answer key - 2021 Part - 1 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: In bee society, all the members are diploid except drones.
    Reason: Drones are produced by parthenogenesis

  • 2)

    In _____ types of natural parthenogenesis only females are produced.

  • 3)

    Assertion (A): Syngamy refers to the fusion of two haploid gametes.
    Reason (R): Syngamy leads to zygote formation.

  • 4)

    A – In human male, testes are extra abdominal and lie in scrotal sacs.
    R – Scrotum acts as thermoregulator and keeps temperature lower by 2oC for normal sperm production

  • 5)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

12th Standard Biology English Medium Reduced Syllabus Model Question paper - 2021 Part - 2 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment

  • 2)

    The site of embryo implantation is the

  • 3)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 4)

    Father of a child is colourblind and mother is carrier for colourblindness, the probability of the child being colourblind is

  • 5)

    DNA and RNA are similar with respect to

12th Standard Biology English Medium Reduced Syllabus Model Question paper - 2021 Part - 1 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The glandular accessory organ which produces the largest proportion of semen is

  • 3)

    Read the given statements and select the correct option
    and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

  • 4)

    Which of the following is true about Rh factor in the offspring of a parental combination DdXDd (both Rh positive)?

  • 5)

    Mangolism is a genetic disorder which is caused by the presence of an extra chromosome number

12th Standard Biology English Medium Reduced Syllabus Important Questions with Answer key - 2021 Part - 2 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The site of embryo implantation is the

  • 3)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 4)

    If the childs blood group is ‘O’ and fathers blood group is ‘A’ and mother’s blood group is ‘B’ the genotype of the parents will be

  • 5)

    Which of the following is incorrect regarding ZW-ZZ type of sex determination?

12th Standard Biology English Medium Reduced Syllabus Important Questions with Answer key - 2021 Part - 1 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    The glandular accessory organ which produces the largest proportion of semen is

  • 3)

    The process which the sperm undergoes before penetrating the ovum is

  • 4)

    A – Ovulation is the release of ovum from the Graafian follicle.
    R – It occurs during the follicular phase of the menstrual cycle.

  • 5)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

12th Standard Biology English Medium Reduced Syllabus Important Questions - 2021 Part - 2 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The whole process of spermatogenesis takes about ______ days.

  • 2)

    Each testis is covered by a fibrous layer _____

  • 3)

    In the year ______    india is expected to become the largest country in population size ______

  • 4)

    Expansion of the RCH is _____

  • 5)

    PCR proceeds in three distinct steps governed by temperature, they are in order of

12th Standard Biology English Medium Reduced Syllabus Important Questions - 2021 Part - 1 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment

  • 3)

    The mature sperms are stored in the

  • 4)

    The glandular accessory organ which produces the largest proportion of semen is

  • 5)

    The process which the sperm undergoes before penetrating the ovum is

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Transverse Binary fission is seen is ______

  • 3)

    Paedogamy is the sexual union of _____

  • 4)

    A few statements describing certain features of reproduction are given below. Select the options that are true for both sexual and asexual reproduction from the options given:
    (i) Gametic fusion takes place
    (ii) Transfer of genetic material takes place
    (iii) Reduction division takes place
    (iv) Progeny have some resemblance, with parents

  • 5)

    The ______ is the smallest human cell.

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    In, dinoflagellates the types of asexual reproduction seen is _____

  • 3)

    Regeneration is not seen in ______

  • 4)

    The male sex hormone testosterone is secreted from

  • 5)

    Testosterone is secreted by ____

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Two - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The mode of reproduction in bacteria is by

  • 2)

    All the following animals are continuous breeders, except.

  • 3)

    The glandular accessory organ which produces the largest proportion of semen is

  • 4)

    Identify the correct statements from the following

  • 5)

    Which of the following phenotypes in the progeny are possible from the parental combination AxB?

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Two - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: In bee society, all the members are diploid except drones.
    Reason: Drones are produced by parthenogenesis

  • 2)

    Ovovivipary is seen in ______

  • 3)

    In _____ types of parthenogenesis egg can develop into individuals of any sex.

  • 4)

    Given below, are a few statements related to external fertilization. Choose the correct statements:
    i. The male and female gametes are formed and released simultaneously
    ii. Only a few gametes are released into the medium
    iii. Water is the medium in a majority of organism exhibiting external fertilization
    iv. Offspring formed as a result of external fertilization have better chance of survival than those formed inside the organism

  • 5)

    The male homologue of the female clitoris is

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Three - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Evolutionary history of an organism is called

  • 2)

    Allergy involves

  • 3)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

  • 4)

    Which of the following is correct for r-selected species

  • 5)

    The Ozone Day is observed every year on September 16 as on this day in 1987 the ___________was signed for launching efforts to arrest the depletion of the fragile ozone layer in the stratosphere that prevents the harmful ultra-violet rays of the sun from reaching the earth. Fill the correct word in blank.

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Three - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason: Asexual reproduction involves only mitosis and no meiosis

  • 2)

    Assertion (A): Asexual reproduction is called blastogenic reproduction.
    Reason (R): It is accomplished by mitotic and meiotic divisions.

  • 3)

    The most important hormone in intiating and maintaining lactation after birth is

  • 4)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 5)

    Which of the following approach does not give the defined action of contraceptive?

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Four - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason: Asexual reproduction involves only mitosis and no meiosis

  • 2)

    Identify the correct option to label the diagram Identify the structure
    1- Immature proglottids
    2 - Gravid proglottids
    3 - Scolex
    4 - Mature proglottids
    5 - Neck

  • 3)

    ______ is not linked to polymenorrhoea

  • 4)

    Klinefelters’ syndrome is characterized by a karyotype of

  • 5)

    A mRNA molecule is produced by

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Four - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    In which mode of reproduction variations are seen

  • 2)

    External fertilization is seen is ______

  • 3)

    Paedogenetic parthenogenesis is seen in ______

  • 4)

    Colostrum is rich in

  • 5)

    This technique is used to diagnose the chromosomal abnormities.

12th Standard Biology English Medium Free Online Test Book Back One Mark Questions - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Transgenic animals are those which have

  • 2)

    The point mutation sequence for transition, transition, transversion and transversion in DNA are

  • 3)

    Which of the following one is used as a Biosensors?

  • 4)

    Virus free plants are developed from

  • 5)

    A free living nitrogen fixing cyanobacterium which can also form symbiotic association with the water fern Azolla

12th Standard Biology English Medium Free Online Test Book Back 1 Mark Questions with Answer Key - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Darwin’s finches are an excellent example of

  • 2)

    Which among the following awards instituted by the Government of India for individuals or communities from rural areas that have shown extraordinary courage and dedication in protecting Wildlife?

  • 3)

    Identify the incorrect pair

  • 4)

    Pure tall plants are crossed with pure dwarf plants. In the F1 generation, all plants were tall. These tall plants of F1 generation were selfed and the ratio of tall to dwarf plants obtained was 3:1. This is called

  • 5)

    Which of the following one is used as a Biosensors?

12th Standard Biology English Medium Free Online Test Book Back One Mark Questions - Part Two - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason: Asexual reproduction involves only mitosis and no meiosis

  • 2)

    Find the wrongly matched pair

  • 3)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375
  • 4)

    Pataus’ syndrome is also referred to as

  • 5)

    Meselson and Stahl’s experiment proved

12th Standard Biology English Medium Free Online Test Book Back 1 Mark Questions with Answer Key - Part Two - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Colostrum is rich in

  • 2)

    A contraceptive pill prevents ovulation by

  • 3)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO X IAIB?

  • 4)

    ZW-ZZ system of sex determination occurs in

  • 5)

    Which of the following statements is not true about DNA replication in eukaryotes?

12th Standard Biology English Medium Free Online Test Book Back One Mark Questions - Part Three - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: In bee society, all the members are diploid except drones.
    Reason: Drones are produced by parthenogenesis

  • 2)

    The foetal membrane that forms the basis of the umbilical cord is

  • 3)

    Identify the correct statements from the following

  • 4)

    Which of the following is not correct?

  • 5)

    Pataus’ syndrome is also referred to as

12th Standard Biology English Medium Free Online Test Book Back 1 Mark Questions with Answer Key - Part Three - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Mammalian egg is

  • 2)

    A – Ovulation is the release of ovum from the Graafian follicle.
    R – It occurs during the follicular phase of the menstrual cycle.

  • 3)

    Assertion : Agrobacterium tumifaciens is popular in genetic engineering because this bacteriumis associated with the root nodules of all cereals and pulse crops
    Reason: A gene incorporated in the bacterial chromosomal genome gets atomatically transferred to the cross with which bacterium is associated.

  • 4)

    The prevention of large scale loss of biological interity

  • 5)

    Pedogenesis refers to

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    During favourable conditions ______ shows multiple fission.

  • 2)

    Testosterone is secreted by ____

  • 3)

    Assertion (A): IUD's are inserted in the ovary.
    Reason (R): IUD's Increases phagocytosis of the sperm.

  • 4)

    The ZW - ZZ type of sex determination is seen ________.

  • 5)

    In gypsy moth we find _________ type of sex determination.

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Giant Amoeba refers to ______

  • 2)

    Testosterone is secreted by ____

  • 3)

    This technique is used to diagnose the chromosomal abnormities.

  • 4)

    The gene responsible for ________ is inherited as an autosomal recessive lethal gene in man

  • 5)

    Pick out the odd man out.

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Two - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    In the geom line gene therapy, the genes are introduced into the______

  • 2)

    Statement 1:ADA deficiency was the first disease treated by gene therapy.
    Statement 2: ADA is an autosomal recessive metabolic disorder

  • 3)

    Cryopreservation of gametes of threatened species in viable and fertile condition can be referred to as

  • 4)

    DB is a standard abbreviation  used for the quantitative expression of

  • 5)

    Identify the incorrect statement.
    (i) EcoSan toilets is a sustainable way for handling human excreta by using dry composting toilets
    (ii) It reduces waste water generation
    (Ui) It is based on recovery and recycling of nutrients from excreta
    (iv) EcoSan toilets are used in several parts of India and Srilanka.

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Two - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The site of infection for yersinia pestis is___________

  • 2)

    Infection of Ascariasis occur due to ___________________

  • 3)

    All the following are recombinant vaccines. Except

  • 4)

    Study the four statements (1 to 4) given below and select the two correct ones out of them.
    1) A lion eating a deer and a sparrow feeding on grain are ecologically similar in being consumers.
    2) Predator starfish Pisaster helps in maintaining species diversity of some invertebrates.
    3) Predators ultimately lead to the extinction of prey species.
    4) Production of chemicals such as nicotine, strychnine by the plants is disordered.
    The two correct statements are

  • 5)

    Select the proper sequence indicating the increasing order of biodiversity.

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Three - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Technique used for cultivation of sponges is based on ______

  • 2)

    In _____ types of parthenogenesis egg can develop into individuals of any sex.

  • 3)

    ______ is a berry shaped duster of cells.

  • 4)

    The ruptured Graafian follicle forms ______

  • 5)

    Why is colostrum recommended to new born baby?

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Three - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Conjugation is seen in _____

  • 2)

    A few statements with regard to sexual reproduction are given below:
    i. Sexual reproduction does not always require two individuals
    ii. Sexual reproduction generally involves gametic fusion
    iii. Meiosis never occurs during sexual reproduction
    iv. External fertilization is a rule during sexual reproduction
    Choose the correct statements from the options below:

  • 3)

    Each testis is covered by a fibrous layer _____

  • 4)

    Which one of the following is not the function of placenta?

  • 5)

    The incubation period for _____ varies between 1-8 months.

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Five - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Isogamy is observed in ______

  • 2)

    ______ cells nourish the sperms.

  • 3)

    In gypsy moth we find _________ type of sex determination.

  • 4)

    The RNA polymerase of prokaryotes binds with ____________ factor to initiate polymerization.

  • 5)

    Continuous consumption of alcohol affects ___________

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Five - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Which among the following animals exhibit ovoviviparity?

  • 2)

    Match and select the correct option

    Column I Column II
    a. Proliferative phase 1. Breakdown of endometrium lining
    b. Secretory phase 2. Follicular phase
    c. Menstruation 3. Luteal phase


  • 3)

    Wodd Breast feeding week is observed during.

  • 4)

    In this Assisted Reproductive Technology (ART), the sperms and egg are allowed to united outside the body and then transformed into the woman's uterus.

  • 5)

    ABO blood group is a classical example for __________

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Four - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Identify the correct option to label the diagram
    1 - Archaeocytes
    2 - Inner membrane
    3 - Micropyle
    4 - Outer membrane
    5 - Monaxonspicules

  • 2)

    Which of the following is not required for any of the techniques of DNA finger printing available at present?

  • 3)

    The process by which organisms with different evolutionary history evolve similar phenotypic adaptations in response to a common environmental challenge is called

  • 4)

    Which of the following is wrongly matched in the given table?

  • 5)

    For transformation, micro-particles coated with DNA to be bombarded with gene gun are made up of

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Four - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Gemmules are ______

  • 2)

    Attachment of blastocyst to the uterine wall is called ______

  • 3)

    This is not Major task of RCH.

  • 4)

    Depending on position of centromere and relative length of two arms human chromosomes can be classified into ________ type.

  • 5)

    ___________ used radioactive labelled molecules to prove that DNA is the genetic material.

12th Standard Botany English Medium Free Online Test One Mark Questions 2020 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    First cell of male gametophyte in angiosperm is

  • 2)

    Which of the following plant was introduced as a contaminant into India along with wheat?

  • 3)

    Identify the correct statement.

  • 4)

    The genotype of a plant showing the dominant phenotype can be determined

  • 5)

    Assertion (A): Test cross is done between F2 hybrid with F. recessive
    Reason (R): It helps to identify the homozygosity of hybrids

12th Standard Botany English Medium Free Online Test One Mark Questions with Answer Key 2020 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Arrange the layers of anther wall from locus to periphery

  • 2)

    A typical anther is ________________

  • 3)

    Observe the diagram and select the correct option mentioning the parts A, B, C and D

  • 4)

    The genotype of a plant showing the dominant phenotype can be determined

  • 5)

    Select the period for Mendel’s hybridization experiments

12th Standard Zoology English Medium Free Online Test One Mark Questions 2020 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    Technique used for cultivation of sponges is based on ______

  • 2)

    Regeneration was first studied by _______

  • 3)

    The male homologue of the female clitoris is

  • 4)

    _____ are endocrine cells.

  • 5)

    Sperms are released into the cavity of the seminiferous tubule by a process called _____

12th Standard Zoology English Medium Free Online Test One Mark Questions with Answer Key 2020 - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    During favourable conditions ______ shows multiple fission.

  • 2)

    Regeneration was first studied by _______

  • 3)

    Mammalian egg is

  • 4)

    _____ may be due to cancer of the ovary.

  • 5)

    The _____ contractions lead to false labour pains.

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Five - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    The male homologue of the female clitoris is

  • 2)

    Identify the correct statements from the following

  • 3)

    Oral contraceptive pills contain synthetic ____ and hormones

  • 4)

    Assertion (A): IUD's are inserted in the ovary.
    Reason (R): IUD's Increases phagocytosis of the sperm.

  • 5)

    Mangolism is a genetic disorder which is caused by the presence of an extra chromosome number

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Six - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    This is a method of sexual reproduction in which individuals of the same species temporarily write and exchange certain. amount of nuclear material and then get separated.

  • 2)

    Find the wrongly matched pair

  • 3)

    The _____ prevents poly spermy.

  • 4)

    Observe the diagram and select the correct option denoting the proper sequence of parts.

  • 5)

    Fatigue, jaundice, fever, rash, stomach pain, liver Cirrhosis and liver failure - are the symptoms of

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Five - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    ______ is a berry shaped duster of cells.

  • 2)

    Statement (1): Menstrual cycle occurs once in every 29 days.
    Statement (2): The average age of menopause is 45-50 years.

  • 3)

    Identify the correct statement.

  • 4)

    Which of the following symbol is used in pedigree analysis to represent unspecified sex?

  • 5)

    How many structural genes are located in lac operon of E.Coli?

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Six - by Suchitra - Gobichettipalayam - View & Read

  • 1)

    According to WHO, India is the ____________ largest HIV affected country.

  • 2)

    Kin selection is seen in _______

  • 3)

    The codon _________ codes for phenylalanine

  • 4)

    AUG code is for ________

  • 5)

    The Neanderthal man had the brain capacity of

View all

TN Stateboard Education Study Materials

TN Stateboard Updated Class 12th Biology Syllabus

Botany - Asexual and Sexual Reproduction in Plants

Introduction - Asexual Reproduction - Vegetative Reproduction - Sexual Reproduction - Pre-fertilization structure and events - Fertilization - Post fertilization structure and events - Apomixis - Polyembryony - Parthenocarpy

Botany - Classical Genetics

Introduction - Heredity and Variation - Mendelism - Laws of Mendelian Inheritance - Monohybrid, Dihybrid, Trihybrid cross, Backcross and Testcross - Interaction of Genes-Intragenic and Intergenic Incomplete dominance, Lethal genes, Epistasis - Polygenic inheritance in Wheat kernel colour, Pleiotropy - Pisum sativum - Extrachromosomal inheritance- Cytoplasmic inheritance in Mitochondria and Chloroplast.

Botany - Chromosomal Basis of Inheritance

Chromosomal theory of Inheritance - Linkage - Eye color in Drosophila and Seed color in Maize - Crossing over, Recombination and Gene mapping - Multiple alleles - Sex determination in plants - Mutation - types, mutagenic agents and their significance.

Botany - Principles and Processes of Biotechnology

Development of Biotechnology - Historical Perspective - Traditional Biotechnology - Advancements in Modern Biotechnology - Tools for Genetic Engineering - Methods of Gene transfer - Screening for Recombiants - Transgenic Plants / Genetically Modifi ed Crops - Applications of Biotechnology.

Botany - Plant Tissue Culture

Milestones in plant tissue culture - Basic concepts in plant disuse culture - Plant tissue culture techniques and types - Plant regeneration pathway - Applications of plant tissue culture - Conservation of plant genetic resources - Intellectual rights of property (IPR), Biosafety and Bioethics - Future Biotechnology

Botany - Principles of Ecology

Ecology - Ecological factors - Ecological adaptations - Dispersal of seeds and fruits

Botany - Ecosystem

Structure of ecosystem - Functions of ecosystem - Plant succession

Botany - Environmental Issues

Greenhouse effect, ozone depletion - Forestry - Deforestation - Afforestation - Alien invasive species - Conservation - Carbon Capture and Storage (CCS) - Rainwater harvesting - Environmental Impact Assessment (EIA) - Geographic Information System

Botany - Plant Breeding

Relationship between human and plants - Domestication of plants - Origin of agriculture - History of agriculture - Organic agriculture - Plant breeding - Conventional plant breeding methods - Modern plant breeding Techniques

Botany - Economically Useful Plants and Entrepreneurial Botany

Food Plants - Spices and Condiments - Fibre - Timber - Latex - Pulp wood - Dye - Cosmetics - Traditional system of medicines - Medicinal plants - Entrepreneurial Botany

Zoology - Reproduction in Organisms

Modes of reproduction - Asexual reproduction - Sexual reproduction

Zoology - Human Reproduction

Human reproductive system - Gametogenesis - Menstrual cycle - Fertilisation and implantation - Maintenance of pregnancy and embryonic development - Parturition and lactation

Zoology - Reproductive Health

Need for reproductive health Problems and strategies - Amniocentesis and its statutory ban - Social impact of sex ratio, female foeticide and infanticide - Population explosion and birth control - Medical termination of pregnancy (MTP) - Sexually transmitted diseases (STD) - Infertility - Assisted reproductive technologies (ART) - Detection of foetal disorders during early pregnancy

Zoology - Principles of Inheritance and Variation

Multiple alleles - Human blood groups - Genetic control of Rh factor - Sex determination in human, insects, and birds - Sex-linked inheritance - Karyotyping - Pedigree analysis - Mendelian disorders - Chromosomal abnormalities

Zoology - Molecular Genetics

Gene as the functional unit of inheritance - In search of the genetic material - DNA is the genetic material - Chemistry of nucleic acids - RNA world - Properties of genetic material - Packaging of DNA helix - DNA Replication - Transcription - Genetic code - tRNA – the adapter molecule - Translation - Regulation of Gene expression - Human Genome Project (HGP) - DNA finger printing technique

Zoology - Evolution

Origin of life - Evolution of life forms - Geological time scale - Biological evolution - Evidences for biological evolution - Theories of biological evolution - Mechanism of evolution - Hardy Weinberg principle - Origin and evolution of man

Zoology - Human Health and Diseases

Common diseases in human beings: Infectious and non-infectious - Maintenance of personal and public hygiene - Basic concepts of immunology - Immunodeficency diseases - Autoimmune diseases - Adolescence – Drug and alcohol abuse - Mental health – Depression

Zoology - Microbes in Human Welfare

Microbes in household products - Microbes in industrial products - Microbes in sewage treatment and energy generation - Microbes in the production of biogas - Microbes as bio-control agents and bio-fertilisers - Bioremediation

Zoology - Applications of Biotechnology

Applications in Medicine - Gene therapy - Stem Cell Therapy - Molecular Diagnosis - Transgenic Animals - Biological products and their uses - Animal cloning - Ethical issues

Zoology - Organisms and Population

Organism and its Environment - Habitat - Major Abiotic Components or Factors - Concept of Biome and Distribution - Responses to abiotic factors - Adaptations - Populations - Population attributes - Population age distribution - Growth models / Curves - Population regulation - Population interactions

Zoology - Biodiversity and its Conservation

Biodiversity - Importance of biodiversity – Global and India - Biogeographical regions of India - Threats to biodiversity - Causes of Biodiversity Loss - IUCN - Biodiversity and its conservation

Zoology - Environmental Issues

Pollution - Air Pollution - Water Pollution - Noise Pollution - Agrochemicals - Biomagnification - Eutrophication - Organic Farming and its Implementation - Solid Waste Management - Global Environment Change - Ozone Depletion - Deforestation - Ecosan Toilets - Peoples Participation in Conservation of Forests

Zoology - Immunology

Basic Concepts of Immunology - Innate Immunity - Acquired Immunity - Immune Responses - Lymphoid Organs - Antigens - Antibodies - Antigen - Antibody Interactions - Vaccines - Vaccination and Immunization - Hypersensitivity - Immunodeficiency Diseases - Autoimmune Diseases - Tumour Immunology

TN StateboardStudy Material - Sample Question Papers with Solutions for Class 12 Session 2019 - 2020

Latest Sample Question Papers & Study Material for class 12 session 2019 - 2020 for Subjects Maths, Chemistry, Physics, Computer Science, Business Maths, Economics, Commerce, Accountancy, History, Computer Applications, Computer Technology, English, உயிரியல், கணினி பயன்பாடுகள், கணினி அறிவியல், வணிகக் கணிதம், வணிகவியல், பொருளியல், கணிதவியல், வேதியியல், இயற்பியல், கணினி தொழில்நுட்பம், வரலாறு, கணக்குப்பதிவியல் in PDF form to free download [ available question papers ] for practice. Download QB365 Free Mobile app & get practice question papers.

More than 1000+ TN Stateboard Syllabus Sample Question Papers & Study Material are based on actual Board question papers which help students to get an idea about the type of questions that will be asked in Class 12 Final Board Public examinations. All the Sample Papers are adhere to TN Stateboard guidelines and its marking scheme , Question Papers & Study Material are prepared and posted by our faculty experts , teachers , tuition teachers from various schools in Tamilnadu.

Hello Students, if you like our sample question papers & study materials , please share these with your friends and classmates.

Related Tags