12th Standard CBSE Syllabus & Materials
12th Standard CBSE
CBSE 12th Economics Government Budget and the Economy Previous year Question Papers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Computer Science Interface Python with MySQL - New Previous year Question Papers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Computer Science Database Concept - New Previous year Question Papers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Computer Science Data Communication - New Previous year Question Papers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Computer Science Data Structures - New Previous year Question Papers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Computer Science Functions - New Previous year Question Papers Study Material - QB365 Set A

Published on: 25/10/2025
Download CBSE Class 12th Standard CBSE Biology question papers, sample papers, important questions, and previous year solved papers in PDF format. Get free study materials, NCERT solutions, and exam preparation resources for Class 12th Standard CBSE Biology
Questions + Answers key
Take MCQ Biology Test

1.
What are auxotrophs?
2.
Define genetic material
3.
Who coined the term 'genetic code'?What does it mean?
4.
Mention the possible levels of regulation of gene expression in eukaryotes.
5.
Pick out the untranslated regions from the following mRNA and mention their location.
5' - ACGUCAUGGCGUUUUAGGAGGAA -3'
6.
Now, Sequencing of total genome is getting less expensive day by day. soon it may be affordable for a common man to get his genome sequenced. what is your opinion could be advantage and disadvantage of this development
7.
The total number of genes in humans is far less (<25000) than the previous estimate (up to 140000 genes).Comment
8.
Why is the Human Genome Project called a mega project?
9.
Explain (in one or two lines) the function of the followings:
(a) Promoter
(b) tRNA
(c) Exons
10.
According to Human Genome Project, about 99.9% nucleotide bases are exactly the same in all human. On the basis of this information answer the following questions.
(i) People may be discriminated on the basis of caste creed, colour and religion. What do you think and Why?
(ii) What percentage of human genome codes for protein?
(iii) Which chromosome has the maximum number of genes & which has their least number.
11.
The biology teacher asked his students to varify the results of experiments on the principle of transformation in bacteria. The teacher made two groups (A + B) of the class students and asked them to submit the report of their findings. One of the
groups (the group B) of the students did not repeat the Griffith's experiment, however the teacher liked it.
Answer the following on the basis of above information-
(1) Which experiment did they perform?
(2) Who performed the transforming principle experiment and when it was it performed.
(3) Give a brief account of the experiment.
(4) What values were exhibited by the students of group B.
12.
(a)Name two types of satellite DNA.Mention the basis for such a classification.
(ii)Show only diagrammatically the process of transcription in bacteria
13.
Describe the steps involved in the sequencing of genome of an organism.
14.
During splicing, the exons are joined and the enzyme which catalyzes this reaction is
RNA ligase
RNA catalase
RNA permease
RNA polymerase
15.
DNA polymerase that helps in DNA replication is of
Two types
Three types
Four types
Only one type
16.
How many base pairs are present in DNA cut by endonuclease
2
4
6
8
17.
How many codons code for amino acids?
64
61
68
60
1.
Mutant organism that cannot grow in the minimal medium and need additional nutrients
2.
A substance which stores biological information,refers it to the next generation,and expresses it in the offspring
3.
Term genetic code was coined by George Gamow.It means that a sequence of 3 successive bases specifies one amino acid in apolypeptide
4.
The possible levels of regulation in eukaryotes could be at
(i) transcriptional level i.e. formation of primary transcript.
(ii) processing level i.e. regulation of splicing
(iii) transport of mRNA from the nucleus to the cytoplasm
(iv) translation level
5.
1. AUGUCG - at the 5' end before the initiation codon.
2. GAGGAA-at the 3' end after the termination codon.
3. They are normally located in front of the initiation codon at the 5' end and behind the termination codon at the 3' end of the coding strand of DNA.
6.
Human genome helps to find out the complete genome sequence of the human. It has many advantage and disadvantage
Advantages:
1) It provides the knowledge of the effect of variation of DNA among individuals can revolutionise the ways to diagnose, treat and prevent many diseases that affect humans.
2) It also provides clues to the understanding of human biology. It helps to find out the human evolution. Identification through DNA forensics is also possible
3) Metabolic defects can be taken care of
Disadvantages:
1) Prior Knowledge of proneness to certain disease will make oneself a worried a lot.
2) Many marriages will breakdown for fear of passage of defects to the offspring
3) Person with a good resistance will become careless
7.
The estimate of a total number of human genes was very high (about 1,40,000 genes) because of a large size of the human genome. However, most of the human genome is made of noncoding repetitive sequences and single nucleotides. Only 2% of the genome actually consist of structural genes which are now estimated to be <25000. some of them are believed to form more than one type of proteins due to alternating splicing.
8.
Human Genome Project
It is a mega project for the following facts:
(i) The human genome has approximately \(3.3\times { 10 }^{ 9 }\) bp; if the cost of sequencing is US $3 per bp. the approximate cost is about US $9 billions.
(ii) If the sequences obtained were to be stored in typed form in books and if each page contained 1000 letters and each book contained 1000 pages, then 3300 such books would be needed to store the information.
(iii) The enormous quantity of data expected to be generated also necessitates the use of high speed computational devices for data storage, retrieval and analysis.
9.
(a) Promoter
This is the sequence of DNA/gene, that provides place for binding of RNA polymerase.
(b) tRNA
It acts as an adapter molecule, that reads the code on the mRNA on one hand and binds to a specific amino acid on the other hand.
By its anticodon, it recognises the codon of the amino acid it carries, and transports the amino acid to the site of protein synthesis.
(c) Exons
These are the regions of eukaryotic gene/DNA, which form parts of RNA and code for different regions in the proteins.
10.
(i) No. such discrimination of people is not at all correct because all the people have the same genetic material.
(ii) Only less then 2% of human genome codes for proteins.
(iii) Chromosome-1 has the most number of genes. It has about 2968 genes and chromosome Y has the least number of genes. It has only 231genes.
11.
(1) The students carried on the experiment performed by Avery, Macleod and McCarty in 1944, who investigated the biochemical nature of transforming principle in Griffith's experiment.
(2) Frederick Griffith performed the transformation experiment in 1928.
(3) Scientific attitude, awareness and respect to their teacher.
12.
(a) Minisatellites and microsatellites
They are classified on the basis of:
(i) base composition, i.e. A- T rich or G-C rich.
(ii) length of the segment.
(iii) number of repetitive units.
13.
Sequencing of a Genome
1. The methods involve two major approaches:
(i) One approach called Expressed Sequence Tags (ESTs), focuses on identifying all the genes that are expressed as RNAs.
(ii) Second approach called Sequence Annotation, is to simply sequence the whole set of genome, that includes all the coding and non-coding sequences and then assigning functions to different regions in the sequence.
2. The total DNA from the cell is isolated and converted into random fragments of relatively smaller sizes.
3. These fragments are then cloned in These fragments are then cloned in suitable hosts using specialised vectors; the commonly used hosts are bacteria and yeast and the vectors are bacterial artificial chromosomes (BAC) and yeast artificial chromosomes (YAC).
4. The fragments are then sequenced using automated DNA sequences.
5. The sequences are then arranged on the basis of certain overlapping regions present in them; this requires the generation of overlapping fragments for sequencing.
6. Specialised computer programmes are developed for alignment of the sequences.
7. These sequences are annotated and assigned to the respective chromosomes.
14.
(a)
RNA ligase
15.
(d)
Only one type
16.
(a)
2
17.
(b)
61
12th Standard CBSE Syllabus & Materials
12th Standard CBSE
CBSE 12th Computer Science Python Revision Tour I - New Previous year Question Papers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Business Studies Planning Important Questions And Answers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Business Studies Business Environment Important Questions And Answers Study Material - QB365 Set A
NEW12th Standard CBSE
CBSE 12th Business Studies Principles of Management Important Questions And Answers Study Material - QB365 Set A
NCERT Books
Syllabus
Exam Pattern
Sample Question Papers
Previous year Question Papers
Important Notes
MCQ Practice test
NCERT Exemplers
Case study Questions
Image Based Questions
Passage based Questions
HOT Questions
Value Based Questions
Model Questions Papers
NCERT ( Book Back ) Questions
Assertion and Reason
Important Questions And Answers
CBSE 12th Standard CBSE Subjects
CBSE Standards