Between the two amino acids (found on charged tRNA), bound to the two sites of the large sub units of bacterial ribosomes, when two 2harged tRNAs are brought close enough, peptide bond is formed with the help of ribozyme.

(i) Mitochondrial codons
(ii) Some protozoans
Since some amino acids are coded by more than one codon hence it is called as degenerate.

Amino acids are activated in the presence of ATP and linked to (cognate) t-RNA.
Carries amino acid to the site synthesis/reaches amino acids to the respective codon.

Macrophages, (Helper) T-Iymphocytes, viral RNA forms DNA by reverse trancription (reverse transcriptase), directs the infected cells to produce viral particles/increase viral progeny.

The features of genetic code are:
(a) Stop codon: does not code for any amino acid /terminates the synthesis of polypeptide chain.
(b) Unambiguous codon: one codon codes (or one amino acid only.
(c) Degenerate codon: some amino acid are coded by more than one codon.
(d) Universal codon : genetic code is same for all organisms (bacteria to humans).

Difference between cistron and an exon:
1. Cistron : A segment of DNA coding for a polypeptide ,chain; the structural gene in a transcription unit could be said as monocistronic (mostly in eukaryotes) or polycistronic (mostly in bacteria or prokaryotes).
2. Exon : The coding sequences or expressed sequences are defined as exons. Exons are said to be those sequences that appear in mature or processed mRNA.

Polarity of the two strands of the fork to be shown and polarity as well as arrow mark of the lagging and leading strands to be shown with correct labellings.

Codingstrand-5'
TACGTACGTACGTACGTACGTACG 3'
mRNAstrand-5'
UACGUACGUACGUACGUACGUACG 3'

Since RNA was unstable and prone to mutations, DNA evolved from RNA with chemical modifications that make it more stable. DNA has double stranded nature and has complementary strands. These further resist changes by evolving a process of repair.

1. Ribozyme-helps in peptide bond formation.
2. Release factor-terminates translation/release polypeptide from ribosome.

DNA ligase facilitates the joining of okazaki fragmente in lagging DNA strands together by catalysing the formation of phosphodiester bond. It also play a role in repairing single-strand breaks in duplex DNA.

hnRNA is required to undergo splicing because of the presence of introns (the non-coding sequences) in it. These need to be removed and the exons (the coding sequences) have to be joined in a specific sequence for translation to take place.

Prokaryotic structural genes are found in continuity without any non-coding region. In contrast, eukaryotic structural genes are divided into exons (coding DNA) and introns (non-coding DNA).

The enzymes involved in DNA replication other than DNA polymerase and ligase are listed below with their functions:

Given, cytosine=20%
\(\therefore \) Percentage of Guanine=20%
Now according to Chargaff's rule, A+T=100-(G+C)
=> A+T=100-40
\(\therefore \) Percentage of Thymine=percentage of Adenine
 =\(\frac { 60% }{ 2 } \)% = 30%

The differences between unambiguous and universal genetic codes are as follows

(ii) The differences between degenerate and initiator codes are as follows

1. Lac is switched only adding lactose in the medium, as lactose acts as inducer and makes repressor inactive.
2. Due to this, \(\beta \) -galactosidase is formed which converts lactose into glucose and galactose. As soon as lactose is consumed, repressor again becomes active cause switching off of the system.

Difference between codons and anticodons are:

Two essential roles played by ribosomes during translation are:
(i) One of the ribosomal RNA (rRNA, 23S in prokaryotes)acts as a transferase ribozyme for the formation of peptide bonds.
(ii) The mRNA and changed tRNAs are attached to ribosomal sites.Thus, these provide sites for the attachment during protein synthesis.

The statement is correct.Because of degeneracy codons, mutations at third base of usually do not result into any change in phenotype.On the other hand, if codon is changed in a way that now it specifies another  amino acid it may alter the protein function as it happens in case of \(\beta \) - globulin of haemoglobin, protein where a substitution of valine instead of glutamic acid causes changes in its structure and function, and resulting into sickle-cell trait.

Unambiguous code means that one codon codes for only the same amino acid, i.e. AUG codes only for methionine. 
Genetic code is universal, as particular codon codes for the same amino acid in all organisms.It is degenerate because some amino acids are coded by more than one codon,e.g UUU and UUC, both code for phenylalanine.

(i) George Gamow suggested that the genetic code should be  made up of a combination of three nucleotides.
(ii) He proposed that there are four bases and 20 amino acids.So, there should be atleast 20 different genetic codes for these 20 amino acids.The only possible combinations that would meet the requirement is combinations of 3 bases that will give 64 codons.

Dr.S.P.Rai Chaudhary and Dr.Lalji Singh

A complete set of gene contained in the haloid does of chromosomes and inherited as a unit from one parent is called geome

Nucleases remove unwanted nucleotides while ligases rejoin useful of nucleic acid (RNA)

Adenine,uracil,guanine,cytosine

RNA polymerase I and III catalyse the transcription of r-RNA and t-RNA respectively

(i) two,spirally coiled, double
(ii),phosphate,dexyribose sugar,nitrogenous basedexyirbonucleotide
(iii) glycosidic,90⁰
(iv) purine,pyrimidine
(v)2 nm (20 \(\mathring { A } \)),3.4nm(34 \(\mathring { A } \))
(vi) semiconservative
(vii) DNA polymerase,RNA,RNA primer
(viii) Leading,Okazaki fragments,lagging.

(a)Molecule 'X' synthesised by 'i ' gene is repressor of the Lac operon.The repressor is inactivated by interaction with the inducer(i.e.,lactose)
(b)The gene 'Z' codes for beta-galactosidase
(c)Transcription of this stops as soon as the inducer is usedup i.e in absence of inducer.Once whole of lactose is consumed and there is no inducer present to blind to the repressor,the repressor becomes active and switches off the operon.

(a) In presence of an inducer(such as lactose or allolactose), the repressor is inactivated by intersection with the inducer.
(b) Transcription of lac mRNA stops when the repress of the operon is synthesised from the i gene.The repress protein binds to the operator region of the operon and stops transcription.
(c) The gene 'Z' codes for beta-galactosidase.

DNA segments that have been separated on an agarose gel by electrophoresis are transferred and permanently affixed to a nylon membrane, a process called southern blotting.The DNA bands are invisible to the eye so that they are flagged with some kind of tag that one can visualize.Therefore,a solution containing radioactive probe is spread over the membrance so that they bind to complementry DNA sequence and then can be visualized by autoradiography.

DNA polymerase catalyses synthesis of DNA and help also in proof-reading

Mutant organism that cannot grow in the minimal medium and need additional nutrients

The bases of DNA sense strands from the promoter to the terminator sites from transcription unit

During RNA processing
(i)unwanted nucleotides are removed
(ii)useful regions are rejoined
(iii)certain nucleotides are added
(iv)some nucleotides are modified, and
(v)folding of molecule

First ribonucleotide in RNA chain is triphosphate, monophosphates

Transcription  occurs in the nucleus during G₁ and G₂ phases of cell cycle in eukaryote,in the cytoplasm and almost continuosly in prolaryotes

Auxotroph,because it needed increase nutrision(G.auxano=to increase),it needed citrulline as it lacked the gene for the enzyme that could catalyse the chage of orithine into citrulline.

Missenses strands acts as a template for the synthesis of sense strand during replication

DNA expresses its genetic information by transcribing mRNA and synthesising proteins

A substance which stores biological information,refers it to the next generation,and expresses it in the offspring

Term genetic code was coined by George Gamow.It means that a sequence of 3 successive bases specifies one amino acid in apolypeptide

In the complete absence of expression of lac operon, permease will not be synthesised; hence,lactose cannot be transported into the cells. If lactose cannot be transported into the cell, then it cannot act as an inducer and cannot relieve the lac operon from its repressed state.

(i) The methylated guanosine cap helps in the binding of mRNA to the smaller subunit of ribosome during initiation of translation.
(ii) Poly-A tail has a direct relatioship with the logevity of mRNA.

hnRNA undergoes splicing to remove introns and join exons.Splicing occurs in the nucleus of the cell.

Synthesis 'a' is continuous(3'--->5') and synthesis 'b' is discontinuous(5'--->3')