Given, cytosine=20%
\(\therefore \) Percentage of Guanine=20%
Now according to Chargaff's rule, A+T=100-(G+C)
=> A+T=100-40
\(\therefore \) Percentage of Thymine=percentage of Adenine
 =\(\frac { 60% }{ 2 } \)% = 30%

(i) two,spirally coiled, double
(ii),phosphate,dexyribose sugar,nitrogenous basedexyirbonucleotide
(iii) glycosidic,90⁰
(iv) purine,pyrimidine
(v)2 nm (20 \(\mathring { A } \)),3.4nm(34 \(\mathring { A } \))
(vi) semiconservative
(vii) DNA polymerase,RNA,RNA primer
(viii) Leading,Okazaki fragments,lagging.

Maintenance of constant internal conditions by organisms for survival. This is achieved by regulating metabolic processes.

Yes.
Many animals other than human have self-consciousness. For example, dolphins are highly intelligent. They have a sense of self and they also recognise others among themselves. They can communicate with each other by whistles, tail slapping, and other body movements. Besides dolphins some other animals such as parrots, chimpanzees, orangutans, gorilla, etc. are also found to have self-consciousness.

The sequence of strand in 3' ⟶ 5' direction
3' - TACGTACGTACGTACGTACGTACGTACG - 5' 
The sequence of strand in 5' ⟶ 3' direction 
5' -  AUGCAUGCAUGCAUGCAUGCAUGCAUGC - 3'

1. The enzyme DNA polymerase polymerises the nucleotides in the   5' -> 3' direction in both continues and discontinuous synthesis.
2. The enzyme DNA-ligase joins the short stretches of DNA of discontinuous synthesis.

(a) Tall and green 3/8 or 6/16
(b) Dwarf and green 1/8 or 2/16
Phenotype ratio = 3:1

Phenotypic ratio : 3 Tall : 1 Dwarf Genotypic ratio : 1 TT : 2 Tt : 1 tt
Two-thirds of the tall progeny is heterozygous.
It is because the gene for tallness (T) is dominant and expresses itself in the heterozygous condition, Tt.

A monohybrid cross is as follows:

\(F_{ 2 }\)

The phenotypic ratio of smooth-seeded to wrinkled-seeded plants, is 3 : 1.
From the Punnett square, it can be seen that one of the smooth-seeded plants is homozygous (55), while the other two are heterozygous (Ss): hence the genotypic ratio is 1 : 2 : 1.

The formula 2ⁿ is applied here
where, n = Number of loci
The organism is heterozygous for 4 loci, n =4
So, 2ⁿ = 2⁴ =2 x 2 x 2 x 2 = 16
The organism will produce 16 types of gametes.

(i)There is no origin of life on the earth taking place today because the earth atmosphere is not reducing but it is oxidising.
(ii) The .energy was provided by an electric discharge and by heating the water chamber and the products obtained in the experiment were amino acids.
(iii) Solar rediations with UV-rays & lightning (electrical discharges) and other high enet:gy rays etc. should have been the energy sources required for the origin of life on the earth.
(iv) The values exhibited by the biology teacher Deepak Gupta are:
(a) caring for his neighbours.
(b) desire to disseminate knowledge as a teacher and
(c) the sound knowledge of the subject.

(a) Round and yellow seeds
(b) Rr Yy

(d) 9 round, yellow seeded: 3 Round, green-seeded: 3 wrinkled, yellow seeded: 1 green, wrinkled - seeded
(e) Yellow-seeds: green seeds = 3 : 1 Round seeds: Wrinkled seeds = 3 : 1

(i) This representation (HbA peptide) indicates a normal human, because the glutamic acid in the sixth position is not substituted by Valine. 
(ii) Since, this disease transnmission follows Mendelian principles, it is called Mendelian disorder.
Inheritance pattern I istransmitled from parents to the oflspring,when both the parners are carriers (heterozygous)of the disease. In this discase, RBCs become sickle-shaped.

The estimate of a total number of human genes was very high (about 1,40,000 genes) because of a large size of the human genome. However, most of the human genome is made of noncoding repetitive sequences and single nucleotides. Only 2% of the genome actually consist of structural genes which are now estimated to be <25000. some of them are believed to form more than one type of proteins due to alternating splicing.

(i) While replicating, the entire DNA molecule to keep the whole molecule stabilised does not open in one go because it would be highly expense energetically. Actually un unwidinsg creates tension in the molecule as uncoiled parts.
Actually, unwinding creates tension in the molecule as uncoiled parts starts forming super coils due to the interaction of exposed nucleotides.
(ii) Replication fork: Instead helicase enzyme, acts on the double strand at or site (origin of replication and a small stretch is unzipped. Immediately. It is held and stabilised by single strand binding  protein.
Slowly with the help of enzymes, exposed strands are copied as a point of unwinding moves and ahead in both direction
It gives an appearence of Y-shaped structure which is called replication fork.
The two functions that the monorner units of NTPs play are:
1. They pair up with exposed nucleotides of the template strand and make phosphodiester linkages and release a pyrophosphate.
2. Hydrolysis of his pyrophosphate by enzyme pyrophosphate release energy that will facilitate making hydrogen bonds between free nucleotides and bases of the template strand

(i) The preferred substrate for bacterial growth is glucose. Bacteria use alternative substrates only when glucose has been depleted.
(ii) The phase X represents the period of slow growth when glucose levels are depleted.
(iii) Bacteria have the ability to use a variety of substrates as carbon sources.
Howerver, glucose is preferred source and in the presence of other substrates like lactose, the growth rate slows down. It is indicated by the lower steepness of growth curve.
or
(iii) In the presence of high glucose concentration the repressor protein remain bound to the operator region, thus preventing the gene expression in lac operon.