Self-incompatibility
It is the third device to prevent inbreeding. It is a genetic phenomenon of preventing the pollen from fertilising ovules of the same flower by inhibiting pollen germination or pollen tube growth in the pistil.

The corpus luteum is formed in the mammalian ovary from a reputed Graaflan follicle after ovulation.It degenerates in the absence of fertilisation as the level of gonadotropins (FSH and LH) drops.

Cyanobacteria are capable of nitrogen fixation. They, however, live in semiaquatic and aquatic habitats. Paddy fields contain water. Therefore, cyanobacteria can be inoculated in these fields for nitrogen fertility.

The separated DNA fragments are stained with ethidium bromide.
Then by exposure to UV-radiation, the separated DNAs become visible as orange-coloured bands.
The separated bands of DNA are cut out from the agarose gel and DNA is extracted from these gel pieces by the process known as elution

The monarch butterfly is highly distasteful to its predators because of a chemical present in its body.
It has acquired it at the caterpillar stage by feeding on a poisonous weed.

The sequence of strand in 3' ⟶ 5' direction
3' - TACGTACGTACGTACGTACGTACGTACG - 5' 
The sequence of strand in 5' ⟶ 3' direction 
5' -  AUGCAUGCAUGCAUGCAUGCAUGCAUGC - 3'

1. When an alien DNA or recombinant DNA is ligated within the coding sequence of an enzyme, the enzyme becomes inactivated; this phenomenon is called insertional inactivation.
2. A recombinant loses the ability to produce a (blue) colour with a chromogenic substrate; hence, it can be distinguished from the non-recombinants, which produce blue-co loured colonies with the chromogenic substrate.
3. This method is preferred to the antibiotic-resistance method as the latter is a cumbersome procedure that requires simultaneous plating on two plates having two different antibiotics.

(i) No, the pollen grains of different species remain viable for different periods of time. e.g. pollen grains of cereals remain viable for less than 30 minutes whereas some members of Rosaceae, Leguminosae and Solanaceae retain the pollen viability for months.
(ii) In the pollen banks, pollen grains are stored in liquid nitrogen (at -196°C).

Many microbial pathogens enter the gut of human along with food. The preventive barriers to protect the body from such pathogens are as follows:
(i) The mucus coating of the epithelium lining of the gut helps in trapping microbes entering the body.
(ii) Saliva in the mouth and hydrochloric acid in gastric juice secreted by stomach prevent microbial growth.

Termination of a polypeptide synthesis:
1)When one of the termination codons (UAA, UAG, UGA) comes at the A-site, it does not code for any amino acid and there is no tRNA molecule for it
2) As a Result, the polypeptide synthesis (or elongation of polypeptide) stops
3)The polypeptide synthesised is released from the ribosome, catalysed by a 'release factor'.

(i) Lactiferous cells of alveoli of mammary glands.They are present in breast.
(ii) Lactation
(iii) Colostrum.
(iv) Oxytocin hormone released by posterior lobe of pituitary body.
(v) Mother's milk is low in fat but rich in proteins such as lactalbumin and lactoprotein. Colostrum also contains major immunoglobin IgA. It provides passive immunity to the newborn baby.

(a) A - Expanding, B - Stable, C- Declining.
(b) Stable population is preferred. It is helpful for planning any welfare activity.
(c) Logistic growth curve.

(a) When air is pumped into the depletiontanks and constantly agiated the aerobic microbes grow vigorously and from flocs.They consume a major part of the organic reduce the BOD of the sewage.

(a) Since tRNA on one hand binds to a specific amino acid and on the other hand reads the codon of the amino acid bound to it through its anticodon, it is called an 'adapter'.
(b)

It actually looks like an inverted L.

i) Restriction enzymes are molecular scissors used in molecular biology for cutting DNA sequences from a specific site. It plays an important role in gene manipulation. The enzyme recognizes a specific 4-8 base pair sequence known as the recognition sequence and cut the sequence at a specific site.
For example, the enzyme EcoRI cuts the DNA between G and A only when the sequence GAATTC is present in the DNA.
↓
5' - GAATTC - 3'
3' - CTTAAG - 5'
↑
Hence, structures called overhangs or sticky ends are generated on each strand. 5'-G and AATTC 3' 3' - CTTAA G5' These sticky ends form hydrogen bonds with their complementary counterparts with the help of DNA ligase.
ii) Plasmid is an extra-chromosomal DNA molecule in bacteria that is capable of replicating, independent of chromosomal DNA.They serve as a vehicle to carry a foreign DNA sequence into a given host cell.
An example of such vector is pBR322.

(a) The HIV replicates in the host by a process of reverse transcription, In this process the viral RNA replicates to form viral DNA with the help of the enzyme reverse transcriptase. This viral DNA then gets incorporated into the host cell DNA which directs the infected cell to produce virus particles.
(b) The HIV infected patients loose immunity because of loss of T-lymphocytes. The HIV enter into helper T-lyphocytes & produce progeny viruses which are released into the blood & attack other helpe T-Iymphocytes. This leads to the progressive decrease in number of T-lymphocytes which results in the loss of immunity as a result of which the patient in unable to protect himself from any type of infection.
(c) The common symptoms of HIV patients are fever, diarhoea, susceptability to other diseases and infections.

(a) Development of female gametophyte: The female reproductive part of a flower is gynoecium, which consists of three parts-stigma, style, and ovary. The ovules are formed in the ovary and attach to it through placenta. The ovule is surrounded by one to two protective layers are called integuments leaving a small opening at one end termed as a micropyle. The stalk of the ovule is called funiculus.The ovule is composed of multi-celled cellular tissue called the nucellus. A hypodermal cell of nucellus toward at the micropylar end enlarges and becomes a megaspore mother cell that undergoes meiosis to form a linear tetrad of four megaspores. Out of four, only one remains functional and three megaspores degenerate. The functional megaspore undergoes three successive mitotic divisions to form eight nuclei, which arrange themselves into three groups. Three: nuclei migrate towards the micro-pylar end and form the egg apparatus. Other three nuclei form antipodal cells at chalazal end. The remaining two nuclei come together as polar nuclei which fuse to form secondary nucleus in the centre of the embryo sac.
(b) Role of endothecium: Microsporangium generally surrounded by wall layers like epidermis, endothecium, 2 or 3 middle layers and the tapetum. Endothecium performs the function of protection and helps in dehiscence of anther to release the pollen
Role of tapetum: It nourishes the developing pollen grains.

(a) Biotic potential.  It is the potential rate of increase or it is the physiological capacity to produce offspring. The biotic potential of human species is estimated to be about 12 per female during the reproductive period of 16 to 44 years of age. The population increases when the number of births exceeds the number of deaths.
(b) Environmental resistance. The factors such as shortage3 of food, disease, predation, environmental natural calamities which impose a check on population size constitute environmental resistance. In case the factors of environmental resistance cannot produce zero growth, the population shows rapid growth. The growth curve will take the shape of 'J'. But in a world with limited resources, environmental resistance does not allow population growth to soar towards infinity.
(c) Carrying capacity. It is a measure of the feeding capacity of an environment or ecosystem for a population of a species under a given set of conditions. The population generally stabilizes around carrying capacity. All environments can sustain only a limited size of population. This limit of constant (K) is called carrying capacity
The carrying of earth for human population is about 50 billions.This figure is likely to be reached is 2100 A.D. if the present rate of growth of population is allowed.

1. It was to show that DNA replication is semi conservative.
2. After completion of replication, each new/daughter molecule of DNA has one parental strand and one newly synthesised strand; this is called semiconservative replication of DNA.
3. Experiment
Mathew Meselson and Franklin Stahl performed the experiment.
4. They grew E.coli. in a medium containing \(^{ 15 }{ { NH }_{ 4 } }Cl,\) until \(^{ 15 }N\) was incorporated in the two strands of newly formed E.coli cells; this 'heavy' DNA can be separated from the normal \(^{ 14 }N-DNA\) by centrifugation in cesium chloride (CsCI) density gradient.
5. Then they transferred the cells into a medium with normal \(^{ 14 }{ { NH }_{ 4 } }Cl\) and took out samples at various time intervals.
6. They extracted the DNA and centrifuged it to measure the densities.
7. The DNA extracted from cells after one generation after transfer from the \(^{ 15 }{ { N } }\) medium to \(^{ 14 }{ { N } }\) medium (i.e. after about 20 minutes), had an intermediate/hybrid density.
8. The DNA extracted after two generations (i.e. after 40 minutes) consisted of equal amounts of 'light' DNA and 'hybrid' DNA.
This proves that after replication, each DNA molecule has one parental strand and one newly synthesised strand, i.e. replication is semiconservative.

(a) Minisatellites and microsatellites
They are classified on the basis of:
(i) base composition, i.e. A- T rich or G-C rich.
(ii) length of the segment.
(iii) number of repetitive units.

(i) The dung and water are the components which gain entry from A point of the digestive chamber.
(ii) Methanogens are the group of bacteria which act upon the dung matter to produce methane. The common methanogenic bacterium is Methanobacterium.
These bacterium need anaerobic condition to digest cellulosic material present in cattle dung.
(iii) The components that get collected in gas holder or chamber are mainly methane gas (CH₄) along with carbon dioxide (CO₂) and hydrogen (H₂) gases used as fuel.

(b) If both Assertion and Reason are true but Reason is not the correct explanation of Assertion.

(a) If both Assertion and Reason are true and Reason is the correct explanation of Assertion.

Both A and R are true and R is not the correct explanation of A.