New ! Biology MCQ Practise Tests



12th Standard English Medium Biology (Zoology) Subject Book Back 5 Mark Questions with Solution Part - I

12th Standard

    Reg.No. :
  •  
  •  
  •  
  •  
  •  
  •  

Biology

Time : 01:00:00 Hrs
Total Marks : 125

    5 Marks

    25 x 5 = 125
  1. How is juvenile phase different from reproductive phase?

  2. Explain the various phases of the menstrual cycle.

  3. Identify the given image and label its parts marked as a, b, c and d

  4. How are STDs transmitted?

  5. The procedure of GIFT involves the transfer of female gametes into the fallopain tube, can gametes be transferred to the uterus to achieve the same result? Explain.

  6. Open Book Assessment
    ‘Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind’ Justify

  7. Discuss the genic balance mechanism of sex determination with reference to Drosophila.

  8. Explain the inheritance of sex linked characters in human being.

  9. Comment on the methods of Eugenics.

  10. If the coding sequence in a transcription unit is written as follows:
    5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA?

  11. Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?

  12. It is established that RNA is the first genetic material. Justify giving reasons.

  13. Mention any three similarities found common in Neanderthal man and Homo sapiens.

  14. A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?

  15. List the common withdrawal symptoms of drugs and alcohol abuse.

  16. Write short notes on the following.
    a) Brewer's yeast
    b) Ideonella sakaiensis
    c) Microbial fuel cells

  17. When does antibiotic resistance develop?

  18. PCR is a useful tool for early diagnosis of an Infectious disease. Elaborate

  19. Explain why cloning of Dolly, the sheep was such a major scientific breakthrough?

  20. Explain how recombinant Insulin can be produced.

  21. Give an account of the properties of soil.

  22. List the adaptations seen in terrestrial animals

  23. Describe Growth Models/Curves.

  24. Mention the major threats to biodiversity caused by human activities. Explain.

  25. Discuss briefly the following :
    a. Catalytic converter
    b. Ecosan toilets

*****************************************

Reviews & Comments about 12th Standard English Medium Biology (Zoology) Subject Book Back 5 Mark Questions with Solution Part - I

Write your Comment