அரையாண்டு மாதிரி வினாத்தாள்

12th Standard TM

    Reg.No. :
  •  
  •  
  •  
  •  
  •  
  •  

உயிரியல்

Time : 02:30:00 Hrs
Total Marks : 70

    பகுதி - I

    அனைத்து வினாக்களுக்கும் விடையளிக்கவும்.

    கொடுக்கப்பட்ட நான்கு விடைகளில் மிகவும் ஏற்புடைய விடையினை தேர்ந்தெடுத்து குறியீட்டுடன் விடையினையும் சேர்த்து எழுதவும்.

    15 x 1 = 15
  1. உறுதிக்கூற்று மற்றும் காரண வினாக்கள் :
    கீழ்க்கண்ட வினாக்களில் இரண்டு கூற்றுகள் கொடுக்கப்பட்டுள்ளன. ஒன்று உறுதிக் கூற்று (உ) ஆகும். மற்றொன்று காரணம் (கா).சரியான விடையை கீழ்க்காணும் வகையில் குறிப்பிடுக.
    உறுதிக்கூற்று: தேனீக்களின் சமூகத்தில் ஆண் தேனீக்களைத் தவிர மற்ற அனைத்தும் இருமயம் கொண்டவை.
    காரணம் : ஆண் தேனீக்கள் கன்னி இனப்பெருக்கம் மூலம் உற்பத்தி செய்யப்படுகின்றன.

    (a)

    'உ' மற்றும் 'கா' இரண்டும் சரியானவை ஆனால் 'கா' என்பது 'உ' வின் சரியான விளக்கம் இல்லை.

    (b)

    ‘உ’ மற்றும் ‘கா’ இரண்டும் சரியானவை ஆனால் 'கா' என்பது 'உ' வின் சரியான விளக்கம் இல்லை.

    (c)

    'உ ' சரியானது ஆனால் 'கா' தவறானது 

    (d)

    'உ' மற்றும் 'கா' இரண்டும் தவறானவை 

  2. ஒரு கருத்தடை மாத்திரை அண்ட செல்வெளியீட்டை எவ்வாறு தடுக்கிறது?

    (a)

    அண்ட நாளத்தில் அடைப்பு ஏற்படுத்துதல்மூலம்

    (b)

    FSH மற்றும் LH ஹார்மோன்கள் சுரத்தலை தடுப்பதன் மூலம்

    (c)

    FSH மற்றும் LH ஹார்மோன்கள் சுரத்தலைதூண்டுவதன் மூலம்

    (d)

    அண்ட செல் விடுபட்டவுடன் அதனை உடனடியாக அழித்துவிடுவதன் மூலம்

  3. ஹர்ஷே மற்றும் சேஸ் ஆய்வுகளின் கண்டுபிடிப்பானது 

    (a)

    சில வைரஸ்களில் RNA மரபுப்பொருள் என்பது 

    (b)

    DNA சில வைரஸ்களில் மரபுப்பொருள் என்பது 

    (c)

    32 P - குறியிடப்பட்ட புரதம் பாக்டீரிய செல்லினுள் வைரஸினால் செலுத்தப்பட்டது.

    (d)

    DNA தோற்ற மாற்றம் செய்வது பாலிசர்க்கரை உறை அல்ல என்பது 

  4. காலாபாகஸ் தீவுகளில் காணப்பட்ட டார்வீனின் குருவிகளின் அலகின் அளவும் விதைகளின் அளவும் ________ தேர்விற்கு உதாரணம் ஆகும்.

    (a)

    நிலைப்படுத்துதல் 

    (b)

    இலக்கு நோக்கிய 

    (c)

    உடைப்பு முறை 

    (d)

    தொகுப்பு முறை 

  5. பிளாஸ்டிமோடியத்தால் ஏற்படும் மலேரியா ______ மூலம் பரவுகின்றது.

    (a)

    காற்று

    (b)

    தொடர்பு

    (c)

    உணவின் மீதுள்ள தெள்ளுப்பூச்சிகள்

    (d)

    கொசு கடித்தல்

  6. சீம்பால் வழங்குவது 

    (a)

    இயற்கையாக பெறப்பட்ட செயலாக்க நோய்த்தடைக்காப்பு 

    (b)

    இயற்கையாக பெறப்பட்ட மந்தமான நோய்த்தடைக் காப்பு 

    (c)

    செயற்கையாக பெறப்பட்ட செயலாக்க நோய்த்தடைக்காப்பு 

    (d)

    செயற்கையாக பெறப்பட்ட மந்தமான நோய்த்தடைக் காப்பு 

  7. காற்றற்ற கசடு செரிப்பானில் உற்பத்தி செய்யப்படும் வாயுக்கள்

    (a)

    மீத்தேன், ஆக்சிஜன் மற்றும் ஹைட்ரஜன்சல்பைடு

    (b)

    ஹைட்ரஜன் சல்பைடு, மீத்தேன் மற்றும் சல்பர் டை ஆக்சைடு

    (c)

    ஹைட்ரஜன் சல்பைடு, நைட்ரஜன் மற்றும் மீத்தேன் 

    (d)

    மீத்தேன், ஹைட்ரஜன் சல்பைடு மற்றும் கார்பன் டை ஆக்சைடு

  8. மறுசேர்க்கை காரணி VIII சீனா ஆம்ஸ்டரின் _________ செல்களில் இருந்து உருவாக்கப்பட்டன

    (a)

    கல்லீரல் செல்கள்

    (b)

    அண்டக செல்கள்

    (c)

    இரத்த செல்கள்

    (d)

    மூளை செல்கள்

  9. சிறு வாழிடம் என்ற சொல்லை முதன் முதலில் பயன்படுத்தியவர் யார்?

    (a)

    சார்லஸ் டார்வின் 

    (b)

    ஜான் ரே 

    (c)

    சார்லஸ் எல்டன் 

    (d)

    கரோலஸ் லின்னேயஸ் 

  10. மயோசோடிஸ் தாவரத்தின் மகரந்தத்துகளின் அளவு _________ மைக்ரோமீட்டர் 

    (a)

    10

    (b)

    100

    (c)

    200

    (d)

    300

  11. வெள்ளரியின் கனி நிறம் இதற்கு உதாரணமாகும்?

    (a)

    ஒடுங்கிய மறைத்தல்

    (b)

    ஓங்கிய மறைத்தல்

    (c)

    நிரப்பு மரபணுக்கள்

    (d)

    தடை ஏற்படுத்தும் மரபணுக்கள்

  12. நுண்பெருக்கம் இதை உள்ளடக்கியது 

    (a)

    நுண்ணுயிர்களைப் பயன்படுத்தி தாவரங்களில் உடல் வழிப்பெருக்கமடையச் செய்தல் 

    (b)

    சிறிய பிரிக்கூறுகளைப் பயன்படுத்தி தாவரங்களில் உடல் வழிப்பெருக்கமடையச் செய்தல் 

    (c)

    நுண்வித்துக்களைப் பயன்படுத்தி தாவரங்களில் உடல் வழிப்பெருக்கமடையச் செய்தல் 

    (d)

    நுண் மற்றும் பெரு வித்துக்களைப் பயன்படுத்தி தாவரங்களில் உடல் வழி அற்ற முறையில் பெருக்கமடையச் செய்தல் 

  13. இந்த விதைகள் தான் உலகில் மிகவும் நீடித்த வாழ்நாளைக் கொண்டுள்ளது.

    (a)

    தாமரை 

    (b)

    ஹைட்ரில்லா 

    (c)

    நிம்பேயா 

    (d)

    மார்சீலியா 

  14. பொங்கேமியா பின்னேட்டா என்ற தாவரம் _________ உரத்திற்கு பயன்படுகிறது

    (a)

    இயற்கை

    (b)

    பொட்டாசியம் நிறைந்த

    (c)

    தழையிலை

    (d)

    கால்சியம் நிறைந்த

  15. _______ ஓர் உயிரிப் பூச்சி விரட்டி(Bio pest repellent) 

    (a)

    புளி 

    (b)

    மிளகாய் 

    (c)

    எள் 

    (d)

    வேம்பு 

  16. பகுதி - II

    எவையேனும் 6 வினாக்களுக்கு விடையளிக்கவும். வினா எண் 24க்கு கட்டாயமாக பதிலளிக்க வேண்டும்.

    6 x 2 = 12
  17. கீழ்க்காணும் அட்டவணையை நிறைவு செய்.

    நோய்கள் நோய்க்காரணி நோய்த்தொற்று இடம் அடைகாக்கும் காலம் 
    புட்டாளம்மை      
    சின்னம்மை      
    டெங்கு காய்ச்சல்      
  18. உயிரிய பல்வகைத் தன்மை இழப்பிற்கான நான்கு காரணங்களைக் கூறு.

  19. தன் மகரந்தச்சேர்க்கை, அயல் மகரந்தச் சேர்க்கை வேறுபடுத்துக்க?

  20. மரபியல் - வரையறு.

  21. வ.எண் கேமீட்டுகளின்
    வகைகள்
    வழித்தோன்றல்களின்
    எண்ணிக்கை
    1. ABC 349
    2. Abc 114
    3. abC 124
    4. AbC 5
    5. aBc 4
    6. aBC 116
    7. ABc 128
    8. abc 360

    i) இந்தச் சோதனைக் கலப்பின் பெயர் என்ன?
    ii) மேலே கொடுக்கப்பட்டுள்ள தரவுகளைக் கொண்டு மரபணு வரைபடத்தை எவ்வாறு
    உருவாக்குவாய் ?
    iii) மரபணுக்களின் சரியான வரிசையைக் கண்டுபிடி.

  22. செயற்கை விதைகள் எவ்வாறு உருவாக்கப்படுகின்றன?

  23. அல்பிடோ விளைவு என்றால் என்ன? அதன் விளைவுகளை எழுதவும்.

  24. தரசத்தில் சேகரிக்கப்படும் ஆற்றல் புற ஆதாரங்களிலிருந்து பெறப்படுகிறது. அதனால் மொத்த ஆற்றலில் லாபமும் இல்லை, இழப்பும் இல்லை? இந்தக் கூற்று உணர்த்தும் நிலை யாது?

  25. முதல்நிலை அறிமுகப்படுத்துதலையு ம் இரண்டாம்நிலை அறிமுகப்படுத்துதலையும் வேறுபடுத்துக.

  26. பகுதி - III

    ஏதேனும் 6 வினாக்களுக்கு விடையளிக்கவும். வினா எண் 33க்கு கட்டாயமாக விடை அளிக்கவும்.

    6 x 3 = 18
  27. கருக்கொலைமற்றும் சிசுக்கொலை வேறுபடுத்துக.

  28. உயிரினங்கள் தோன்றியது பற்றிய அனைத்து மத நம்பிக்கையும் என்ன கூறுகிறது?

  29. பின்வருவனற்றுக்கிடையே உள்ள வேறுபாடுகளை எழுதுக.
    சுயதடைகாப்பு நோய்மற்றும் தடைகாப்புக் குறைவு நோய்.

  30. உயிர் உரங்களாக நுண்ணுயிரிகளின் பங்கினை நியாயப்படுத்துக.

  31. உடல்செல் மரபணு சிகிச்சை, மற்றும் இனச்செல் மரபணு சிகிச்சை வேறுபடுத்துக

  32. அழியும் நிலை சிற்றினங்கள் என்றால் என்ன? எடுத்துக்காட்டுடன் விளக்குக

  33. சுற்றுச்சூழல் மாசுபாட்டினை குறைப்பதில் தனி நபரின் பங்கினை விவாதி?

  34. தாவரங்களில் செய்யப்பட்டுள்ள நுணப்பெருக்கத்திற்கு எடுத்துக்காட்டு தருக.

  35. ஒருவர் தினமும் ஒரு கோப்பை காஃபி அருந்துவது அவருடைய ஆரோக்கியத்திகு உதவும். இது சரியா? சரியென்றால் நன்மைகளை வரிசைப்படுத்து.

  36. பகுதி - IV

    அனைத்து வினாக்களுக்கும் விடையளிக்கவும்.

    5 x 5 = 25
    1. இரண்டாம் நிலை உற்பத்தித்திறன் என்றால் என்ன? அதன் வகைகள் யாவை? குழும உற்பத்தித்திறன் எவ்வாறு கணக்கிடப்படுகிறது?

    2. சில தாவரங்களின் இருப்பு அல்லது இல்லாமை எங்கு நிலவும் சூழலைச் சுட்டிக்காட்டும் விதத்தில் காணப்படும்? இது எவ்வாறு அழைக்கப்படுகிறது?

    1. வேம்பு மற்றும் மஞ்சள் இவற்றில் நடைபெற்ற உயிரிப்பொருள் கொள்ளை முயற்சிகளை விவரி.

    2. மரபணுவளக்கூறு பாதுகாப்பு பற்றி நீர் அறிவது என்ன? அவற்றை விவரி.

    1. வடகிழக்கு இந்தியாவில் இடம் மாறும் வேளாண்மை பல்வகைத்தன்மையின் முக்கியமான அச்சுறுத்தலாகும்-நிரூபி.

    2. கருவூண்திசு என்றால் என்ன? அதன் வகைகளை விவரி.

    1. உயிர் எதிர்ப்பொருள் எதிர்ப்புத்திறன் எப்பொழுது உருவாகிறது?

    2. இனக்கூட்டச் சார்பின் பல்வேறு தேவைகள் யாவை? அவற்றின் வகைகளை விளக்குக.

    1. கீழ்க்காணும் படியெடுத்தல் அலகிற்கான குறியீட்டு வரிசையின் படி, உருவாக்கப்படும் தூது ஆர்.என்.ஏ வில் உள்ள நியூக்ளிடைடு வரிசையினை எழுதுக.
      5' TGCATGCATGCATGCATGCATGCATGC 3'

    2. எச்.ஐ.வியின் அமைப்பை பற்றி விவரி.

       

*****************************************

TN 12th Standard TM free Online practice tests

Reviews & Comments about 12th உயிரியல் அரையாண்டு மாதிரி வினாத்தாள் ( 12th Biology Half Yearly Model Question Paper )

Write your Comment