Tamilnadu Board Biology Question papers for 12th Standard (English Medium) Question paper & Study Materials

12th Standard Biology English Medium - Important 5 Mark Question Paper and Answer Key 2022 - 2023 Biology Important 5 Mark Question With Answers - by Study Materials View & Read

  • 1)

    Give reasons for the following:
    (a) Some organisms like honey bees are called parthenogenetic animals
    (b) A male honey bee has 16 chromosomes where as its female has 32 chromosomes

  • 2)

    The following is the illustration of the sequence of ovarian events (a-i) in a human female.

    a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents.
    b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events.
    c) Explain the changes that occurs in the uterus simultaneously in anticipation.
    d) Write the difference between C and H.

  • 3)

    How are STDs transmitted?

  • 4)

    Brief about female heterogamety.

  • 5)

    a) Identify the figure given below
    b) Redraw the structure as a replicating fork and label the parts
    c) Write the source of energy for this replication and name the enzyme involved in this process.
    d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.

12th Standard Biology English Medium - Important 3 Mark Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which type of reproduction is effective -Asexual or sexual and why?

  • 2)

    Identify the given image and label its parts marked as a, b, c and d

  • 3)

    Select the correct term from the bracket and complete the given branching tree

    (Barriers, Lactational amenorrhoea, CuT, Tubectomy)

  • 4)

    Explain the mode of sex determination in honeybees.

  • 5)

    Distinguish between structural gene, regulatory gene and operator gene

12th Standard Biology English Medium - Important 2 Mark Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Why is the offspring formed by asexual reproduction referred as a clone?

  • 2)

    What is inhibin? State its functions

  • 3)

    Differentiate foeticide and infanticide

  • 4)

    What are holandric genes?

  • 5)

    Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

12th Standard Biology English Medium - Important 1 Mark MCQ's Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The mode of sexual reproduction in bacteria is by ______.

  • 2)

    The male sex hormone testosterone is secreted from _____.

  • 3)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 4)

    The milk secreted by the mammary glands soon after child birth is called ______.

  • 5)

    Identify the correct statements from the following.

12th Standard Biology English Medium - Revision Model Question Paper with Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The mode of sexual reproduction in bacteria is by ______.

  • 2)

    The foetal membrane that forms the basis of the umbilical cord is _____.

  • 3)

    Which of the following statements about DNA replication is not correct?

  • 4)

    B cells that produce and release large amounts of antibody are called

  • 5)

    Cyclosporin – A is an immunosuppressive drug produced from _______

12th Standard Biology English Medium Zoology - Immunology 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Tabulate the types of Innate immunity and explain the mechanism involved.

  • 2)

    Explain the role of thymus as an lymphoid organ.

  • 3)

    Write a note on different types of antigen antibody reactions.

  • 4)

    Describe the structure of HIV with a diagram.

12th Standard Biology English Medium Zoology - Immunology 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are the cells involved innate immune system?

  • 2)

    Why is opsonisation efficient in phagocytosis?

  • 3)

    What is vaccine? What are its types?

  • 4)

    A person is infected by HIV. How will you diagnose for AIDS?

  • 5)

    Autoimmunity is a misdirected immune response. Justify.

12th Standard Biology English Medium Zoology - Immunology 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Mention the types of acquired immunity and write two differences between them.

  • 2)

    Differentiate between primary and secondary Immune response.

  • 3)

    Differentiate primary and secondary lymphoid organs with an example.

  • 4)

    What is bursa of fabricius?

  • 5)

    Write a.note an spleen as a lymphoid organ.

12th Standard Biology English Medium Zoology - Immunology 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate between:
    Innate immunity and acquired immunity

  • 2)

    Differentiate between:
    Primary and secondary immune responses

  • 3)

    Differentiate between:
    Active and passive immunity

  • 4)

    Differentiate between:
    Humoral and CMI immunity

  • 5)

    Differentiate between:
    Autoimmune disease and Immunodeficiency disease

12th Standard Biology English Medium Zoology - Immunology 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Define immunity.

  • 2)

    Define innate immunity.

  • 3)

    Define acquired immunity.

  • 4)

    Describe the location of the thymus gland.

  • 5)

    What is MALT and BALT?

12th Standard Biology English Medium Zoology - Immunology 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role.

  • 2)

    How does saliva act inbody defence?

  • 3)

    How does immune system work?

  • 4)

    Name and explain the type of barriers which involve macrophages.

  • 5)

    What are interferons? Mention their role.

12th Standard Biology English Medium Zoology - Immunology 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Lysozyme is an example of _______

  • 2)

    ______ is not a feature of acquired immunity.

  • 3)

    Passive immunity does not exhibit this characteristic.

  • 4)

    ______ is not a secondary lymphoid organ.

  • 5)

    This statement about the thymus which is not true.

12th Standard Biology English Medium Zoology - Immunology 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Colostrum provides

  • 2)

    Paratope is an

  • 3)

    Allergy involves

  • 4)

    Anaphylactic shock is due to

  • 5)

    Spread of cancerous cells to distant sites is termed as

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write the botanical name, origin, cultivational area and uses of Black gram.
    Botanical name : Vigna mungo

  • 2)

    Give a detailed account on anyone fibe yielding plant.

  • 3)

    Draw a table mentioning binominals, family name, useful part and their medical uses of any five local medicinal plants

  • 4)

    Explain the stepwise preparation of Bio-pest repellent from the leaves of Azadirachta indica

  • 5)

    What are the uses of rubber?

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write the origin and area of cultivation of green gram and red gram.

  • 2)

    What is TSM? How does it classified and what does it focuses on?

  • 3)

    Give an account on the role of Jasminum in perfuming

  • 4)

    Write the economic importance of rice.

  • 5)

    What are psychoactive drugs? Add a note Marijuana and Opium

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write a short note on foxtail millet.

  • 2)

    Give a botanical name of green gram and write its  origin andarea of cultivation and uses.

  • 3)

    Mention the ways in which mangoes are used in Indian culinary.

  • 4)

    Write a note on origin and area of cultivation of cotton.

  • 5)

    What is vulcanization? Who invented it?

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Discuss which wood is better for making furniture.

  • 2)

    A person got irritation while applying chemical dye. What would be your suggestion for alternative?

  • 3)

    Which is called as the “King of Bitters”? Mention their medicinal importance.

  • 4)

    Differentiate bio-medicines and botanical medicines.

  • 5)

    What are millets? What are its types? Give example for each type.

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Give the binomials of paddy and wheat.

  • 2)

    What is maida? Mention its culinary purpose.

  • 3)

    Name any four millet varieties.

  • 4)

    Ragi rich food helps to overcome bone related ailments - justify.

  • 5)

    Eating millets is good for diabetic patients. How?

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write the cosmetic uses of Aloe.

  • 2)

    What is pseudo cereal? Give an example.

  • 3)

    Name the humors that are responsible for the health of human beings.

  • 4)

    Give definitions for organic farming?

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Paddy, Wheat and Sorghum, etc., comes under the category of cereals. All the members ofcereals belong to which of the following family?

  • 2)

    Match the common names of the given plant species with their respective binomial

    (A) Paddy (I) Vigna radiata
    (B) Lady's finger  (II) Titicum aestivum
    (C) Wheat  (III) Oryza sativa
    (D) Green gram (IV) Abelmoschus esculentus
  • 3)

    Identify the tamil name for flaked rice

  • 4)

    Pigeon pea is the common name for _______

  • 5)

    Statement 1: Arachis hypogea belongs to Fabaceae
    Statement 2: It is a native of Brazil.

12th Standard Biology English Medium Botany - Economically Useful Plants and Entrepreneurial Botany 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Consider the following statements and choose the right option.
    i) Cereals are members of grass family.
    ii) Most of the food grains come from monocotyledon.

  • 2)

    Assertion: Vegetables are important part of healthy eating.
    Reason: Vegetables are succulent structures of plants with pleasant aroma and flavours.

  • 3)

    Groundnut is native of ____.

  • 4)

    Statement A: Coffee contains caffeine
    Statement B: Drinking coffee enhances cancer

  • 5)

    Tectona grandis is coming under family _____.

12th Standard Biology English Medium Botany - Plant Breeding 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Give a comparative account on Seaweed liquid fertilizer.

  • 2)

    Explain the steps involved in hybridization.

  • 3)

    What are the changes in a plant due to domestication?

  • 4)

    Why should we choose Plant Breeding techniques?

  • 5)

    How was green revolution originated in India?

12th Standard Biology English Medium Botany - Plant Breeding 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are the different types of hybridization?

  • 2)

    Write a note on heterosis.

  • 3)

    List out the new breeding techniques involved in developing new traits in plant breeding.

12th Standard Biology English Medium Botany - Plant Breeding 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    In 1926, Vavilov initially proposed eight main geographic centres of crop origin. Mention any six of them.

  • 2)

    Name any three eminent plant breeders of Indian origin.

  • 3)

    How Rhizobium acts as an efficient bio- fertiIizer?

  • 4)

    Azolla increases the yield of paddy crop - support your answer.

  • 5)

    Mention any three advantages of Arbuscular mycorrhizal association.

12th Standard Biology English Medium Botany - Plant Breeding 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is meant by domestication of plants?

  • 2)

    Mention any two free-living nitrogen-fixing bacteria.

  • 3)

    What are bio-pesticides? Why they are considered better than synthetic pesticides?

  • 4)

    Name any four plants used in Green leaf manuring

  • 5)

    What is plant breeding?

12th Standard Biology English Medium Botany - Plant Breeding 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate between primary introduction from secondary introduction.

  • 2)

    How are microbial innoculants used to increase the soil fertility?

  • 3)

    Explain the best suited type followed by plant breeders at present?

12th Standard Biology English Medium Botany - Plant Breeding 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    ________is the process of bringing a plant species under human control.

  • 2)

    Which of the following scientist developed world's first cotton hybrid?

  • 3)

    Identify the incorrect statement:

  • 4)

    Which is not a free-living nitrogen-fixing species?

  • 5)

    Arbuscular mycorrhizae is a symbiotic association between ____________

12th Standard Biology English Medium Botany - Plant Breeding 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Assertion(A): Genetic variation provides the raw material for selection
    Reason(R): Genetic variations are differences in genotypes of the individuals.

  • 2)

    While studying the history of domestication of various cultivated plants _______ were recognized earlier

  • 3)

    Pick out the odd pair

  • 4)

    Match Column I with Column II

    Column I Column II
    i) William S. Gaud I) Heterosis
    ii) Shull II) Mutation breeding
    iii) Cotton Mather III) Green revolution
    iv) Muller and Stadler IV) Natural hybridization
  • 5)

    The quickest method of plant breeding is _______.

12th Standard Biology English Medium Botany - Environmental Issues 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List out the major effects of Ozone Depletion.

  • 2)

    What are the objectives of Afforestation programme?

  • 3)

    How Eichhornia crassiper spoils the Indian ecosystem?

  • 4)

    Write a comparative note on Carbon Foot Print (CFP).

  • 5)

    Explain a) green house effect and b) global warming.

12th Standard Biology English Medium Botany - Environmental Issues 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Suggest a solution to water crisis and explain its advantages.

  • 2)

    Explain afforestation with case studies.

  • 3)

    What are the effects of deforestation and benefits of agroforesty?

12th Standard Biology English Medium Botany - Environmental Issues 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List out the effects of global warming.

  • 2)

    Mention any three sources of carbon dioxide emission.

  • 3)

    What are the adverse effects of global warming on plants?

  • 4)

    Suggest few ways to overcome global warming.

  • 5)

    Ozone acts as a natural sunscreen - Justify.

12th Standard Biology English Medium Botany - Environmental Issues 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    How do sacred groves help in the conservation of biodiversity?

  • 2)

    Which one gas is most abundant out of the four commonest greenhouse gases? Discuss the effect of this gas on the growth of plants?

12th Standard Biology English Medium Botany - Environmental Issues 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Define Greenhouse gases and list out its examples

  • 2)

    Name any four greenhouse gases.

  • 3)

    Define global warming.

  • 4)

    Methane is one of a potent green house gas. Point out a few sources from where methane is generated.

  • 5)

    List out the anthropogenic sources of Nitrous oxide.

12th Standard Biology English Medium Botany - Environmental Issues 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is ozone hole?

  • 2)

    Give four examples of plants cultivated in commercial agroforestry.

  • 3)

    Expand CCS. (or) What is CCS?

  • 4)

    How do forests help in maintaining the climate?

12th Standard Biology English Medium Botany - Environmental Issues 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    ___________ is not a method of waste water treatment.

  • 2)

    Which is not a greenhouse gas?

  • 3)

    Identify the incorrect statement with regard to Global warming

  • 4)

    The total ozone layer over the earth surface is ____________________

  • 5)

    Methane is ________________ times as effective as CO2 at trapping heat.

12th Standard Biology English Medium Botany - Environmental Issues 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which of the following would most likely help to slow down the greenhouse effect.

  • 2)

    With respect to Eichhornia
    Statement A: It drains off oxygen from water and is seen growing in standing water.
    Statement B: It is an indigenous species of our country.

  • 3)

    Find the wrongly matched pair.

  • 4)

    Depletion of which gas in the atmosphere can lead to an increased incidence of skin cancer?

  • 5)

    One green house gas contributes 14% of total global warming and another contributes 6%. These are respectively identified as _____.

12th Standard Biology English Medium Botany - Ecosystem 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain various steps involved in decomposition (or) Write the steps involved in the mechanism decomposition. 

  • 2)

    Write an essay on pond ecosystem.

  • 3)

    Write a note on the strategies of ecosystem management.

  • 4)

    List out the characteristics of ecological succession.

  • 5)

    Differentiate Primary succession and Secondary succession.

12th Standard Biology English Medium Botany - Ecosystem 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Generally in summer the forest are affected by natural fire. Over a period of time it recovers itself by the process of successions .Find out the types of succession and explain.

  • 2)

    Draw a pyramid from following details and explain in brief.
    Quantities of organisms are given-Hawks - 50, plants - 1000.rabbit and mouse - 250 + 250, pythons and lizard - 100 + 50 respectively.

  • 3)

    Various stages of succession are given bellow. From that rearrange them accordingly. Find out the type of succession and explain in detail.
    Reed-swamp stage, phytoplankton stage, shrub stage, submerged plant stage, forest stage, submerged free floating stage, marsh medow stage.

12th Standard Biology English Medium Botany - Ecosystem 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is secondary productivity? Explain its types.

  • 2)

    List the factors affecting primary productivity.

  • 3)

    Explain the concept of trophic level in an ecosystem.

  • 4)

    State the second law ofthermodynamics.

  • 5)

    Explain Grazing food chain with example.

12th Standard Biology English Medium Botany - Ecosystem 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Discuss the gross primary productivity is more efficient than net primary productivity.

  • 2)

    Construct the food chain with the following data.
    Hawk, plants, frog, snake, grasshopper.

  • 3)

    Name of the food chain which is generally present in all type of ecosystem. Explain and write their significance.

  • 4)

    Shape of pyramid in a particular ecosystem is always different in shape. Explain with example.

  • 5)

    Generally human activities are against to the ecosystem, where as a student how will you help to protect ecosystem?

12th Standard Biology English Medium Botany - Ecosystem 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    According to A.G. Tansley, what is an ecosystem?

  • 2)

    Mention any two climatic factors and edaphic factors of an ecosystem.

  • 3)

    Define 'Standing state' with regard to ecosystem.

  • 4)

    What are biotic components?

  • 5)

    Name the macro consumers and micro consumers.

12th Standard Biology English Medium Botany - Ecosystem 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Productivity of profundal zone will be low. Why?

  • 2)

    Pyramid of energy is always upright. Give reasons

  • 3)

    What will happen if all producers are removed from ecosystem?

12th Standard Biology English Medium Botany - Ecosystem 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Ecosystem is the structural and functional unit of ecology. This statement was given by _______

  • 2)

    Identify the incorrect option among the following component sequence.

  • 3)

    Pick out the edaphic factor among the following.

  • 4)

    Which is not a macro consumer?

  • 5)

    Photosynthetically Active Radiation ranges between the wavelength of __________

12th Standard Biology English Medium Botany - Ecosystem 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which of the following is not a abiotic component of the ecosystem?

  • 2)

    Which of the following is / are not a natural ecosystem?

  • 3)

    Pond is a type of ______.

  • 4)

    Pond ecosystem is _______.

  • 5)

    Profundal zone is predominated by heterotrophs in a pond ecosystem, because of ______.

12th Standard Biology English Medium Botany - Principles of Ecology 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain various edaphic factors that affect vegetation.

  • 2)

    What does competition refers to? Classify and describe it.

  • 3)

    Point out any five morphological adaptations of epiphytes.

  • 4)

    Explain the role of edaphic factors on vegetation.

  • 5)

    Explain various types of interaction inclusive of both positive & negative with examples.

12th Standard Biology English Medium Botany - Principles of Ecology 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Describe the mutual relationship between the fig and wasp and comment on the phenomenon that operates in this relationship.

  • 2)

    What is soil profile? Explain the characters of different soil horizons.

  • 3)

    Give an account of various types of parasitism with examples.

  • 4)

    Explain different types of hydrophytes with examples.

  • 5)

    Enumerate the anatomical adaptations of xerophytes.

12th Standard Biology English Medium Botany - Principles of Ecology 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate habitat from niche.

  • 2)

    What is thermal stratification? Explain its types.

  • 3)

    What are the adverse effects of temperature on plant?

  • 4)

    Explain briefly about the three types of fire.

  • 5)

    Classify soil based on its formation.

12th Standard Biology English Medium Botany - Principles of Ecology 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Distinguish habitat and niche

  • 2)

    What is Albedo effect and write their effects?

  • 3)

    What is mutualism? Mention any two example where the organisms involved are commercially exploited in modern agriculture.

  • 4)

    List any two adaptive features evolved in parasites enabling them to live successfully on their host?

  • 5)

    Mention any two significant roles of predation plays in nature.

12th Standard Biology English Medium Botany - Principles of Ecology 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    How Earnest Haeckel defined ecology?

  • 2)

    What is ecological hierarchy?

  • 3)

    Sequentially arrange the different units of ecological hierarchy.

  • 4)

    Define
    (a) Autecology
    (b) Synecology

  • 5)

    What is Niche?

12th Standard Biology English Medium Botany - Principles of Ecology 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Define ecology.

  • 2)

    What is ecological hierarchy? Name the levels of ecological hierarchy. 

  • 3)

    What are ecological equivalents? Give one example

  • 4)

    Why are some organisms called as eurythermals and some others as stenohaline ?

  • 5)

    ‘Green algae are not likely to be found in the deepest strata of the ocean’. Give at least one reason.

12th Standard Biology English Medium Botany - Principles of Ecology 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Autoecology deals with the study of ___________.

  • 2)

    The ideal soil for Cultivation is:

  • 3)

    The study of soil is called as __________

  • 4)

    Identify the indicators of fire.

  • 5)

    Statement 1: Latitudes represent distance from the equator.
    Statement 2: Height above the seal level from longitude.

12th Standard Biology English Medium Botany - Principles of Ecology 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Arrange the correct sequence of ecological hierarchy starting from lower to higher level.

  • 2)

    Ecology is the study of an individual species is called
    i) Community ecology
    ii) Autecology
    iii) Species ecology
    iv) Synecology

  • 3)

    A specific place in an ecosystem, where an organism lives and performs its functions is _____.

  • 4)

    Read the given statements and select the correct option.
    i) Hydrophytes possess aerenchyma to support themselves in water.
    ii) Seeds of Viscum are positively photoblastic as they germinate only in presence of light.
    iii) Hygroscopic water is the only soil water available to roots of plant growing in soil as it is present inside the micropores.
    iv) High temperature reduces use of water and solute absorption by roots

  • 5)

    Which of the given plant produces cardiac glycosides?

12th Standard Biology English Medium Botany - Plant Tissue Culture 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the steps involved in protoplast culture.

  • 2)

    Point out the applications of plant tissue culture.

  • 3)

    Discuss the protocol for micropropagation of banana.

  • 4)

    Enumerate the advantages of Artificial seeds.

  • 5)

    Briefly explain about patents.

12th Standard Biology English Medium Botany - Plant Tissue Culture 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the basic concepts involved in plant tissue culture

  • 2)

    Based on the material used, how will you classify the culture technology? Explain it.

  • 3)

    Write the protocol for artificial seed preparation.

12th Standard Biology English Medium Botany - Plant Tissue Culture 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Compare Redifferentiation with Dedifferentiation.

  • 2)

    How the autoclaving is done for culture media?

  • 3)

    Briefly explain the surface sterilization of explants.

  • 4)

    Point out the factors that determine success rate of tissue culturing.

  • 5)

    Mention any three macronutrients and micro nutrients used in MS medium.

12th Standard Biology English Medium Botany - Plant Tissue Culture 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    How will you avoid the growing of microbes in nutrient medium during culture process? What are the techniques used to remove the microbes?

  • 2)

    Write the various steps involved in cell suspension culture.

  • 3)

    What do you mean Embryoids? Write its application.

  • 4)

    Give an account on Cryopreservation.

  • 5)

    What do you know about Germplasm conservation. Describe it.

12th Standard Biology English Medium Botany - Plant Tissue Culture 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Define tissue culture.

  • 2)

    Name the four basic concepts of plant tissue culture.

  • 3)

    What is the term totipotency refers to?

  • 4)

    Define sterilization.

  • 5)

    Mention the way by which culture media and explants are sterilized.

12th Standard Biology English Medium Botany - Plant Tissue Culture 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is the name of the process given below? Write its 4 types.

  • 2)

    Give the examples for micro propagation performed plants .

12th Standard Biology English Medium Botany - Plant Tissue Culture 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Identify the group of scientists who developed the intergenic hybrid - the pomato.

  • 2)

    The production of secondary metabolites require the use of _________.

  • 3)

    Which of the following condition favours callus induction?

  • 4)

    Protoplast are the cells devoid of ___________

  • 5)

    A widely used fusogen in protoplast culture is ________

12th Standard Biology English Medium Botany - Plant Tissue Culture 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Totipotency refers to _____.

  • 2)

    Micro propagation involves _____.

  • 3)

    Match the following :

    1) Totipotency A) Reversion of mature cells into meristerm
    2) Dedifferentiation B) Biochemical and structural changes of cells
    3) Explant C) Properties of living cells develops into entire plant
    4) Differentiation D) Selected plant tissue transferred to culture medium
  • 4)

    The time duration for sterilization process by using autoclave is ______ minutes and the temperature is ______.

  • 5)

    Which of the following statement is correct

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain how fermentation is done in bioreactor ?

  • 2)

    List out the application of single-cell protein.

  • 3)

    Give a short notes on Green Fluorescent Protein (GFP)

  • 4)

    Explain the steps involved in recombinant DNA technology

  • 5)

    Explain in detail about various types of direct gene transfer method.

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    How do you use the biotechnology in modern practice?

  • 2)

    Mention the application of Biotechnology.

  • 3)

    Is there any possibilities to transfer a suitable desirable gene to host plant without vector? Justify your answer.

  • 4)

    Compare the various types of Blotting techniques

  • 5)

    Write the advantages of herbicide tolerant crops

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Mention any three historical events which took place in the 21st century for the development of biotechnology.

  • 2)

    In the fermentation process, what does upstream and downstream refers to? Explain.

  • 3)

    What are secondary metabolites? Give two examples.

  • 4)

    What is SCP? Mention its nutritional value.

  • 5)

    Mention any three algal species used for SCP production.

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    You are working in a biotechnology lab with a becterium namely E.coli. How will you cut the nucleotide sequence? explain it.

  • 2)

    What do you know about the word pBR332?

  • 3)

    What are restriction enzyme. Mention their type with role in Biotechnology.

  • 4)

    How will you identify a vector ?

  • 5)

    Write the advantages and disadvantages of Bt cotton.

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write about the modern biotechnology.

  • 2)

    What is a fermentor?

  • 3)

    Define fermentation.

  • 4)

    What are primary metabolites? Give example.

  • 5)

    How microbial enzymes are produced? Mention its significance.

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are the materials used to grow microorganism like Spirulina?

  • 2)

    What are the enzymes you can used to cut terminal end and internal phospho di ester bond of nucleotide sequence?

  • 3)

    Name the chemicals used in gene transfer.

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which of the following person coined the term biotechnology?

  • 2)

    Zymology deals with __________

  • 3)

    Identify the incorrect statement:

  • 4)

    Pick out the mismatched pair(s):
    (i) Arnphotericin-B - Streptomyces notatum
    (ii) Penicillin - Penicillum nodosus
    (iii) Streptomycin - Streptomyces grises
    (iv) Tetracycline - Streptomyces aureofacins

  • 5)

    Identify the non-fungal species used in SCP production.
    (i) Candida
    (ii) Chlorella
    (iii) Chlamydomonas
    (iv) Cellulomonas

12th Standard Biology English Medium Botany - Principles and Processes of Biotechnology 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Restriction enzymes are _____.

  • 2)

    Plasmids are ______.

  • 3)

    EcoRI cleaves DNA at ____.

  • 4)

    Genetic engineering is _____.

  • 5)

    Consider the following statements:
    I. Recombinant DNA technology is popularly known as genetic engineering is a stream of biotechnology which deals with the manipulation of genetic materials by man invitro
    II. pBR322 is the first artificial cloning vector developed in 1977 by Boliver and Rodriguez from E.coli plasmid
    III. Restriction enzymes belongs to a class of enzymes called nucleases.
    Choose the correct option regarding above statements

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    "The process of arrangement if the same order genes more than one in the same chromosome."
    1. What is the process known as?
    2. Explain its types.

  • 2)

    Draw a flow chart depicting the various types of ploidy.

  • 3)

    Explain hyperploidy with its types.

  • 4)

    What is translocation? Write about its types.

  • 5)

    Write the important aspects about the chromosome behavior during meiosis.

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    When two different genes came from same parent they tend to remain together.
    i) What is the name of this phenomenon?
    ii) Draw the cross with suitable example.
    iii) Write the observed phenotypic ratio.

  • 2)

    If you cross dominant genotype PV/PV male Drosophila with double recessive female and obtain F1 hybrid. Now you cross F1 male with double recessive female.
    i) What type of linkage is seen?
    ii) Draw the cross with correct genotype.
    iii) What is the possible genotype in F2 generation?

  • 3)

    Write the salient features of Sutton and Boveri concept.

  • 4)

    How is Nicotiana exhibit self-incompatibility. Explain its mechanism.

  • 5)

    How sex is determined in monoecious plants. write their genes involved in it.

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are the salient features of the chromosomal theory of inheritance ?

  • 2)

    Compare Mendelian factors with chromosome.

  • 3)

    State Coupling and Repulsion theory.

  • 4)

    Give a short note on incomplete linkage.

  • 5)

    How crossing over differs from linkage?

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the mechanism of crossing over.

  • 2)

    Write the steps involved in molecular mechanism of DNA recombination with diagram.

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write anyone contribution of the following scientists to the field of molecular biology.
    (a) Hugo de Vries
    (b) Sutton and Boveri

  • 2)

    Define linkage. Mention its types.

  • 3)

    What does the condition synteny refers to?

  • 4)

    What are linked genes?

  • 5)

    Who coined the term crossing over? When does the crossing over occurs in a cell?

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)
    s.no gamete types Number of progenies
    1 ABC 349
    2 Abc 114
    3 abC 124
    4 AbC 5
    5 aBc 4
    6 aBC 116
    7 ABc 128
    8 abc 360

    i) What is the name of this test cross?
    ii) How will you construct gene mapping from the above given data?
    iii) Find out the correct order of genes.

  • 2)

    What is the difference between missense and nonsense mutation?

  • 3)


    From the above figure identify the type of mutation and explain it.

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Name the scientist(s) who rediscovered the Mendelian work?
    (i) Hugo de Vries
    (ii) Carl Correns
    (iii) Tschermak
    (iv) T.H. Morgan

  • 2)

    Which is not a feature of the chromosomal theory of inheritance?

  • 3)

    The following sequence represents the location of genes in a chromosome. A - B - C - M - R - S - y -Z. Which of the gene pairs will have least chance of getting inherited together?

  • 4)

    Number of chromosomes (2n) in Ophioglossum is _________

  • 5)

    Identify the syntenic gene from the given genes sequence of a chromosome G-H-I-J-K-L-M-A-B

12th Standard Biology English Medium Botany - Chromosomal Basis of Inheritance 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    An allohexaploidy contains ______.

  • 2)

    The A and B genes are 10 cm apart on a chromosome. If an AB/ab heterozygote is testcrossed to ab/ab, how many of each progeny class would you expect out of 100 total progeny?

  • 3)

    Match list I with list II

    List I list II
    A. A pair of chromosomes extra with diploid i) monosomy
    B. One chromosome extra to the diploid ii) tetrasomy
    C. One chromosome loses from diploid iii) trisomy
    D.Two individual chromosomes lose from diploid

    iv) double monosomy

  • 4)

    Which of the following sentences are correct?
    1. The offspring exhibit only parental combinations due to incomplete linkage
    2. The linked genes exhibit some crossing over in complete linkage
    3. The separation of two linked genes are possible in incomplete linkage
    4. Crossing over is absent in complete linkage

  • 5)

    Accurate mapping of genes can be done by three point test cross because increases _____.

12th Standard Biology English Medium Botany - Classical Genetics 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain Dihybrid cross in pea plant.

  • 2)

    How does the wrinkled gene make Mendel's peas wrinkled? Find out the molecular explanation.

  • 3)

    Describe incomplete dominance exhibited by Mirabilis jalapa.

  • 4)

    Write an essay on Mendel's life history.

  • 5)

    Explain Mendel's empirical approach on heredity.

12th Standard Biology English Medium Botany - Classical Genetics 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are the reasons for Mendel’s successes in his breeding experiment?

  • 2)

    Explain the law of dominance in monohybrid cross.

  • 3)

    Describe dominant epistasis with an example. 

  • 4)

    Explain polygenic inheritance with an example.

  • 5)

    Differentiate continuous variation with discontinuous variation.

12th Standard Biology English Medium Botany - Classical Genetics 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Point out any three importance of variations.

  • 2)

    List out the reasons for the selection of pea plant by Mendel.

  • 3)

    State the law of segregation.

  • 4)

    How many types of gametes are produced by heterozygous dihybrid plant with a genotype RrYy? Write them.

  • 5)

    Define trihybrid cross. Mention its F 2 phenotypic ratio.

12th Standard Biology English Medium Botany - Classical Genetics 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate incomplete dominance and codominance.

  • 2)

    What is meant by cytoplasmic inheritance

12th Standard Biology English Medium Botany - Classical Genetics 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Who coined the term genetics? Also, define it.

  • 2)

    Name the four major subdisciplines of genetics.

  • 3)

    Explain Heredity and variations

  • 4)

    Mendel's theory is a particulate theory - justify

  • 5)

    Which organism was studied by Gregor Mendel? How many traits does he considered on his experiments

12th Standard Biology English Medium Botany - Classical Genetics 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Name the seven contrasting traits of Mendel.

  • 2)

    What is meant by true breeding or pure breeding lines / strain?

  • 3)

    Give the names of the scientists who rediscovered Mendelism

  • 4)

    What is back cross?

  • 5)

    Define Genetics.

12th Standard Biology English Medium Botany - Classical Genetics 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The term 'Genetics' was introduced by__________

  • 2)

    Which is not a correct statement?
    (A) Variations are the raw materials for evolution
    (B) Variations provide genetic material for natural selection
    (C) It helps the individual to adapt to the changing environment
    (D) Variations allow breeders to improve the crop field

  • 3)

    An allede is__________

  • 4)

    Gregor Mendel ___________
    (i) was born in Czechoslovakia
    (ii) did his experiments in Pisum fulvum
    (iii) was the first systemic researcher in genetics
    (iv) Published his results in the paper "Experiments on Plant Hybrids"

  • 5)

    How many characters studied by Mendel in pisum sativum

12th Standard Biology English Medium Botany - Classical Genetics 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in _____.

  • 2)

    In order to find out the different types of gametes produced by a pea plant having the genotype AaBb, it should be crossed to a plant with the genotype _____.

  • 3)

    How many different kinds of gametes will be produced by a plant having the genotype AABbCC?

  • 4)

    Which one of the following is an example of polygenic inheritance?

  • 5)

    In Mendel’s experiments with garden pea, round seed shape (RR) was dominant over wrinkled seeds (rr), yellow cotyledon (YY) was dominant over green cotyledon (yy). What are the expected phenotypes in the F2 generation of the cross RRYY x rryy?

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Give a comparative account on Anther wall layers

  • 2)

    Describe the development process of male gametophyte.(or) Explain the different mode of entry of pollen tube into the ovule.

  • 3)

    Write about the different types of ovules.

  • 4)

    Describe the development of monosporic embryo sac.

  • 5)

    Give the characteristic features of Anemophilous plants.

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the conventional methods adopted in vegetative propagation of higher plants.

  • 2)

    Highlight the milestones from the history of plant embryology.

  • 3)

    Discuss the importance of Modern methods in reproduction of plants.

  • 4)

    Write short note on Heterostyly.

  • 5)

    Enumerate the characteristic features of Entomophilous flowers

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    How tongue grafting differs from wedge grafting?

  • 2)

    List any three advantages of micropropagation

  • 3)

    Where the stomium is located? What is its role?

  • 4)

    Briefly explain about the types of tapetum.

  • 5)

    What are the functions of tapetum

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    A detached leaf of Bryophyllum produces new plants. How?

  • 2)

    Differentiate Grafting and Layering.

  • 3)

    Distinguish mound layering and air layering.

  • 4)

    What is endothelium

  • 5)

    What is polyembryony. How it can commercially exploited.

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write the names of organisms that undergo the following types of asexual reproduction.
    (a) Budding
    (b) fragmentation
    (c) Regeneration
    (d) Gemma cup formation.

  • 2)

    What are diaspores?

  • 3)

    Name the vegetative propagules of the following plants
    (a) Allium cepa
    (b) Zingiber Officinalis
    (c) Agave
    (d) Colocasia

  • 4)

    Point out the advantages of natural vegetative reproduction

  • 5)

    Mention any two conventional propagation techniques

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is reproduction?

  • 2)

    Mention the contribution of Hofmeister towards Embryology.

  • 3)

    List out two sub-aerial stem modifications with example.

  • 4)

    What is layering?

  • 5)

    What are clones?

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The unit of reproductive structure used in vegetative propagation is called as __________________

  • 2)

    Which of the following aquatic plant is popularly known as the "Terror of Bengal"?

  • 3)

    The genetic ability of a plant cell to produce the entire plant is said to be ________________

  • 4)

    A typical anther is ________________

  • 5)

    Innermost layer of anther wall is ________________

12th Standard Biology English Medium Botany - Asexual and Sexual Reproduction in Plants 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Choose the correct statement from the following

  • 2)

    An eminent Indian embryologist is ______.

  • 3)

    Identify the correctly matched pair.

  • 4)

    Pollen tube was discovered by ______.

  • 5)

    Size of pollen grain in Myosotis ______.

12th Standard Biology English Medium Zoology - Environmental Issues 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is the primary purpose of the Kyoto Protocol?

  • 2)

    In what way Peyang conserves the forest?

  • 3)

    Describe how deforestation might contribute to global warming

  • 4)

    How does forest conservation help to reduce air pollution?

  • 5)

    List the effects of air pollution.

12th Standard Biology English Medium Zoology - Environmental Issues 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List all the wastes that you generate, at home, school or during your trips to other places. Could you very easily reduce the generation of these wastes? Which would be difficult or rather impossible to reduce?

  • 2)

    How can we control eutrophication?

  • 3)

    Discuss the role of an individual to reduce environmental pollution.

  • 4)

    Discuss briefly the following :
    a. Catalytic converter
    b. Ecosan toilets

12th Standard Biology English Medium Zoology - Environmental Issues 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Why does ozone hole form over Antarctica?

  • 2)

    Mention the causes of enhanced use of ultraviolet radiation

  • 3)

    Discuss the role of women in protection and conservation of forests.

  • 4)

    What are particulate matter?

  • 5)

    Name the main sources of air pollution.

12th Standard Biology English Medium Zoology - Environmental Issues 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is SMOG and how it is harmful for us?

  • 2)

    Write notes on the following:
    a. Eutrophication
    b. Algal Bloom

  • 3)

    What are some solutions to toxic dumping in our oceans?

12th Standard Biology English Medium Zoology - Environmental Issues 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Discuss the causes and effects of global warming. What measures need to be taken to control global warming?

  • 2)

    What would Earth be like without the greenhouse effect?

  • 3)

    How are pollutants classified?

  • 4)

    Define air pollution.

  • 5)

    What is AQI?

12th Standard Biology English Medium Zoology - Environmental Issues 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Expand
    (i) CFC
    (ii) AQI
    (iii) PAN

  • 2)

    What effect can fertilizer runoff have on an aquatic ecosystem?

  • 3)

    How does recycling help reduce pollution?

12th Standard Biology English Medium Zoology - Environmental Issues 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    With which of the following, the Agenda 21’ of Rio Summit, 1992 is related to?

  • 2)

    Which among the following awards instituted by the Government of India for individuals or communities from rural areas that have shown extraordinary courage and dedication in protecting Wildlife?

  • 3)

    The Ozone Day is observed every year on September 16 as on this day in 1987 the ___________was signed for launching efforts to arrest the depletion of the fragile ozone layer in the stratosphere that prevents the harmful ultra-violet rays of the sun from reaching the earth. Fill the correct word in blank.

  • 4)

    The Hydrochlorofluorocarbons (HCFCs) are the compounds which have the following molecules:

  • 5)

    __________ is an example for a non persistant pollutant.

12th Standard Biology English Medium Zoology - Environmental Issues 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Right to Clean Water is a fundamental right, under the Indian Constitution

  • 2)

    The ‘thickness’ of Stratospheric Ozone layer is measured in/on:

  • 3)

    As per 2017 statistics, the highest per capita emitter of Carbon dioxide in the world is

  • 4)

    The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as

  • 5)

    Which among the following always decreases in a Food chain across tropic levels?

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    ‘Stability of a community depends upon its species diversity’ Justify the statement.

  • 2)

    Write a note on extinction and its types

  • 3)

    Write a note on gene banks

  • 4)

    Write the general strategies in conservation?

  • 5)

    Give an account on genetic diversity and community diversity.

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is mass extinction? Will you encounter one such extinction in the near future. Enumerate the steps to be taken to prevent it.

  • 2)

    In north eastern states, the jhum culture is a major threat to biodiversity – substantiate.

  • 3)

    List out the various causes for biodiversity losses

  • 4)

    How can we contribute to promote biodiversity conservation?

  • 5)

    Write a note on
    i) Protected areas,
    ii) Wild life sanctuaries,
    iii) WWF.

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Extinction of a keystone species led to loss of biodiversity – Justify.

  • 2)

    Where are biodiversity hotspots normally located? Why?

  • 3)

    Why is biodiversity so important and worthy of protection?

  • 4)

    Why has the dodo become extinct?

  • 5)

    What is an endangered species?

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Compare and Contrast the insitu and exsitu conservation. (or) What are the differences between in-situ and ex-situ conservation ?

  • 2)

    What are called endangered species? Explain with examples

  • 3)

    Why do we find a decrease in biodiversity distribution, if we move from the tropics towards the poles?

  • 4)

    What are the factors that drive habitat loss?

  • 5)

    Alien species invasion is a threat to endemic species – substantiate this statement.

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Why do animals have greater diversification than plant diversity?

  • 2)

    Define species diversity.

  • 3)

    What is ecosystem/community diversity?

  • 4)

    Give an equation for Species-Area relationship on a log scale

  • 5)

    What is habitat fragmentation?

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Define endemism

  • 2)

    How many hotspots are there in India? Name them

  • 3)

    What are the three levels of biodiversity?

  • 4)

    Name the active chemical found in the medicinal plant Rauwolfia vomitoria. What type of diversity it belongs to?

  • 5)

    “Amazon forest is considered to be the lungs of the planet”- Justify this statement.

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    There are ________ mega biodiversity countries in the world

  • 2)

    The Species-Area relationship was given by ___________

  • 3)

    The grizzled squirrel and lion tailed Macaque are endemic to _____________

  • 4)

    ___________ is a biographical gateway for much of India's flora and fauna.

  • 5)

    _____________ is not a threat to biodiversity.

12th Standard Biology English Medium Zoology - Biodiversity and its Conservation 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which of the following region has maximum biodiversity

  • 2)

    Conservation of biodiversity within their natural habitat is

  • 3)

    Which one of the following is not coming under insitu conservation

  • 4)

    Which of the following is considered a hotspots of biodiversity in India?

  • 5)

    The organization which published the red list of species is

12th Standard Biology English Medium Zoology - Organisms and Population 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List the adaptations of aquatic animals.

  • 2)

    List the differences between R selected and K selected species.

  • 3)

    Write the characteristics of tundra.

  • 4)

    Write about the essential properties of water.

  • 5)

    List out the properties of soil

12th Standard Biology English Medium Zoology - Organisms and Population 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are the ways by which organisms respond to abiotic factors?

  • 2)

    Classify the adaptive traits found in organisms

  • 3)

    Give an account of the properties of soil.

  • 4)

    List the adaptations seen in terrestrial animals

  • 5)

    Describe Growth Models/Curves.

12th Standard Biology English Medium Zoology - Organisms and Population 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is ecological density, crude density and population density?

  • 2)

    Draw a diagram to show age distribution in a increasing population.

  • 3)

    Draw a sketch to show J and S shaped growth form of a population.

  • 4)

    How is the camel able to withstand desert conditions?

  • 5)

    Eurythermy is advantageous to the animal. Justify.

12th Standard Biology English Medium Zoology - Organisms and Population 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain hibernation and aestivation with examples.

  • 2)

    Give the diagnostic characters features of a Biome

  • 3)

    Differentiate Natality and Mortality

  • 4)

    Differentiate J and S shaped curve

  • 5)

    Give an account of population regulation

12th Standard Biology English Medium Zoology - Organisms and Population 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is Zero Stress?

  • 2)

    What are ecological equivalents?

  • 3)

    Define 'niche'.

  • 4)

    State Bergmann's rule.

  • 5)

    State Allen's rule.

12th Standard Biology English Medium Zoology - Organisms and Population 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is a Habitat?

  • 2)

    Define ecological niche.

  • 3)

    What is Acclimatisation?

  • 4)

    What is Pedogenesis?

  • 5)

    What is soil permeability?

12th Standard Biology English Medium Zoology - Organisms and Population 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What type of human population is represented by the following age pyramid?

  • 2)

    The word 'niche' was first used by __________

  • 3)

    Van't Hoffs rule describes the impact of ____________ on the environment.

  • 4)

    "Birds and mammals attain greater body size in colder regions than warmer regions." - Choose the correct option.

  • 5)

    Which of the following is a behavioural adaptation?

12th Standard Biology English Medium Zoology - Organisms and Population 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    All populations in a given physical area are defined as

  • 2)

    Organisms which can survive a wide range of temperatuer are called

  • 3)

    The interaction in nature, where one gets benefit on the expense of other is...

  • 4)

    Predation and parasitism are which type of interactions?

  • 5)

    Competition between species leads to

12th Standard Biology English Medium Zoology - Applications of Biotechnology 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List the adaptations of aquatic animals.

  • 2)

    List the differences between R selected and K selected species.

  • 3)

    Write the characteristics of tundra.

  • 4)

    Write about the essential properties of water.

  • 5)

    List out the properties of soil

12th Standard Biology English Medium Zoology - Applications of Biotechnology 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain how “Rosie” is different from a normal cow

  • 2)

    How was Insulin obtained before the advent of rDNA technology? What were the problems encountered?

  • 3)

    Explain how ADA deficiency can be corrected

  • 4)

    What are stem cells? Explain its role in the field of medicine

  • 5)

    Mention the advantages (3) and disadvantages of cloning (3).

12th Standard Biology English Medium Zoology - Applications of Biotechnology 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is HbsAg?

  • 2)

    What is gene therapy? Mention the types

  • 3)

    What is gene augmentation therapy?

  • 4)

    Differentiate embryonic and adult stem cells

  • 5)

    What is a stem cell bank?

12th Standard Biology English Medium Zoology - Applications of Biotechnology 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Mention the number of primers required in each cycle of PCR. Write the role of primers and DNA polymerase in PCR. Name the source organism of the DNA polymerase used in PCR.

  • 2)

    How is the amplification of a gene sample of interest carried out using PCR?

  • 3)

    What is genetically engineered Insulin?

  • 4)

    ELISA is a technique based on the principles of antigen-antibody reactions. Can this technique be used in the molecular diagnosis of a genetic disorder such as Phenylketonuria?

  • 5)

    Gene therapy is an attempt to correct a Genetic defect by providing a normal gene into the individual. By this the function can be restored. An alternate method would be to provide gene product known as enzyme replacement therapy, which would also restore the function. Which in your opinion is a better option? Give reasons for your answer.

12th Standard Biology English Medium Zoology - Applications of Biotechnology 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Define pluripotency

  • 2)

    What does ELISA stands for?

  • 3)

    Name the types of ELISA test.

  • 4)

    What is denaturation?

  • 5)

    What is annealing?

12th Standard Biology English Medium Zoology - Applications of Biotechnology 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    PCR is a useful tool for early diagnosis of an Infectious disease. Elaborate

  • 2)

    What is alpha lactalbumin?

  • 3)

    What is significance oflactalbumin?

  • 4)

    What is hGH?

  • 5)

    What is factor VIII?

12th Standard Biology English Medium Zoology - Applications of Biotechnology 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

  • 2)

    Insulin was first isolated by_______

  • 3)

    Alpha lactalbumin is a protein with___________minoacids.

  • 4)

    Interferons are produced using________

  • 5)

    The two chains of Insulin molecule are attached by_______

12th Standard Biology English Medium Zoology - Applications of Biotechnology 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The first clinical gene therapy was done for the treatment of

  • 2)

    Dolly, the sheep was obtained by a technique known as

  • 3)

    The genetic defect adenosine deaminase deficiency may be cured permanently by

  • 4)

    How many amino acids are arranged in the two chains of Insulin

  • 5)

    PCR proceeds in three distinct steps governed by temperature, they are in order of

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is the key difference between primary and secondary sewage treatment?

  • 2)

    Explain the process of sewage treatment.

  • 3)

    Explain the working of a biogas plant

  • 4)

    Explain the role of microbes in the production of enzymes & bio-active molecules

  • 5)

    Describe the stages of Sewage treatment process

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write short notes on the following.
    a) Brewer's yeast
    b) Ideonella sakaiensis
    c) Microbial fuel cells

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the role of cry-genes in genetically modified crops.

  • 2)

    Write the key features of organic farming.

  • 3)

    Justify the role of microbes as a bio-fertilizer

  • 4)

    Mention a therapeutic use of Yeast.

  • 5)

    How is yoghurt produced?

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    How is milk converted into curd? Explain the process of curd formation

  • 2)

    When does antibiotic resistance develop?

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is biological oxygen demand?

  • 2)

    What are probiotics? Give examples.

  • 3)

    What are prebiotics?

  • 4)

    What are antibiotics?

  • 5)

    Why were Chain and Florey awarded Nobel Prize?

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Give any two bioactive molecules produced by microbes and state their uses.

  • 2)

    List the advantages of biogas plants in rural areas.

  • 3)

    Define the following terms:
    a) Antibiotics
    b) Zymology
    c) Superbug

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Cry toxins obtained from Bacillus thuringiensis are effective against for______

  • 2)

    Which of the following bacteria is used extensively as a bio-pesticide?

  • 3)

    Which of the following is not involved in nitrogen fixation?

  • 4)

    The enzyme________is got from Aspergillus.

  • 5)

    WorId Biofuel day is observed on_______

12th Standard Biology English Medium Zoology - Microbes in Human Welfare 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which of the following microorganism is used for production of citric acid in industries?

  • 2)

    Which of the following pair is correctly matched for the product produced by them?

  • 3)

    The most common substrate used in distilleries for the production of ethanol is_________

  • 4)

    Cyclosporin – A is an immunosuppressive drug produced from _______

  • 5)

    CO2 is not released during

12th Standard Biology English Medium Zoology - Human Health and Diseases 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List any five bacterial diseases causative agents, mode of transmission of syndrome.

  • 2)

    Write a note on any two protozoen diseases

  • 3)

    List any five viral diseases, their casuative agents, site of infection, mode of transmission and symptoms

  • 4)

    Explain the events in life cycle of plasmodium in the secondary host/Man

  • 5)

    Give an account of helminthic disease.

12th Standard Biology English Medium Zoology - Human Health and Diseases 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role. Liver, thymus, stomach, thyroid, tonsils.

  • 2)

    Explain the process of replication of retrovirus after it gains entry into the human body.

  • 3)

    What is vaccine? What are its types?

12th Standard Biology English Medium Zoology - Human Health and Diseases 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is signet ring stage?

  • 2)

    How are viral diseases classified?

  • 3)

    Name two methods by which mosquito population can be controlled to prevent malaria

  • 4)

    Name the fungal organisms which cause skin infections.

  • 5)

    Write a few lines about filarial worm.

12th Standard Biology English Medium Zoology - Human Health and Diseases 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Name and explain the type of barriers which involve macrophages.

  • 2)

    Explain the structure of immunoglobulin with suitable diagram.

  • 3)

    What are the cells involved innate immune system.

  • 4)

    List the causative agent, mode of transmission and symptoms for Diptheria and Typhoid.

  • 5)

    A patient was hospitalized with fever and chills. Merozoites were observed in her blood. What is your diagnosis?

12th Standard Biology English Medium Zoology - Human Health and Diseases 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Define communicable diseases

  • 2)

    Name the phases in the life cycle of Plasmodium 

  • 3)

    What are non-infectious diseases?

  • 4)

    Name the causal agent of swine flu. Mention two symptoms.

  • 5)

    What is a zoonotic virus?

12th Standard Biology English Medium Zoology - Human Health and Diseases 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are interferons? Mention their role.

  • 2)

    List out chemical alarm signals produced during inflammation.

  • 3)

    A person is infected by HIV. How will you diagnose for AIDS?

  • 4)

    Autoimmunity is a misdirected immune response. Justify.

12th Standard Biology English Medium Zoology - Human Health and Diseases 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    _________is a non infective disease.

  • 2)

    Rigidity of the Jaw muscle is a symptom of__________

  • 3)

    The site of infection for yersinia pestis is___________

  • 4)

    Choose the symptom applicable for mumps

  • 5)

    ___________is a pandemic disease

12th Standard Biology English Medium Zoology - Human Health and Diseases 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    A 30 year old woman has bleedy diarrhoea for the past 14 hours, which one of the following organisms is likely to cause this illness?

  • 2)

    Exo-erythrocytic schizogony of Plasmodium takes place in _______

  • 3)

    The sporozoites of Plasmodium vivax are formed from ________

  • 4)

    Amphetamines are stimulants of the CNS, whereas barbiturates are ______

  • 5)

    The Athlete’s foot disease in human is caused by _______

12th Standard Biology English Medium Zoology - Evolution 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Mention any three similarities found common in Neanderthal man and Homo sapiens.

  • 2)

    Explain the theory of chemical evolution.

  • 3)

    Explain Urey & Miller's experiment.

  • 4)

    Write about the two principles of Lamarck's theory.

  • 5)

    Explain about the objections to Darwinism.

12th Standard Biology English Medium Zoology - Evolution 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the three major categories in which fossilization occur?

  • 2)

    Explain how mutations, natural selection and genetic drift affect Hardy Weinberg equilibrium.

  • 3)

    Taking the example of Peppered moth, explain the action of natural selection. What do you call the above phenomenon?

  • 4)

    Darwin's finches and Australian marsupials are suitable examples of adaptive radiation – Justify the statement

  • 5)

    How does Mutation theory of De Vries differ from Lamarck and Darwin’s view in the origin of new species.

12th Standard Biology English Medium Zoology - Evolution 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate between the eating habit and brain size of Australopithecus and Ramapithecus.

  • 2)

    State the theory of spontaneous generation.

  • 3)

    Define evolution.

  • 4)

    What are Coacervates?

  • 5)

    How can we determine the age of fossils?

12th Standard Biology English Medium Zoology - Evolution 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate between divergent evolution and convergent evolution with one example for each.

  • 2)

    How does Hardy-Weinberg’s expression (p2 + 2pq + q2 = 1) explain that genetic equilibrium is maintained in a population? List any four factors that can disturb the genetic equilibrium.

  • 3)

    How did Darwin explain fitness of organisms?

  • 4)

    Who disproved Lamarck’s Theory of acquired characters? How?

  • 5)

    Rearrange the descent in human evolution
    Austrolopithecus → Homo erectus → Homo sapiens → Ramapithecus → Homo habilis.

12th Standard Biology English Medium Zoology - Evolution 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What are atavistic organs?

  • 2)

    State the Biogenetic law.

  • 3)

    What are molecular clocks?

  • 4)

    What is the view of Neo Lamarckism?

  • 5)

    What are coprolites?

12th Standard Biology English Medium Zoology - Evolution 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List out the major gases seems to be found in the primitive earth.

  • 2)

    Mention the main objections to Darwinism.

  • 3)

    How does Neanderthal man differ from the modern man in appearance?

12th Standard Biology English Medium Zoology - Evolution 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The solar system is estimated to be _______________years old.

  • 2)

    Carbon dioxide in the primitive earth is said to have been formed from ___________

  • 3)

    The term biogenesis was coined by

  • 4)

    _____________ was not a part of theory of chemical evolution.

  • 5)

    Origin of fishes occurred in ___________ period

12th Standard Biology English Medium Zoology - Evolution 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The first life on earth originated

  • 2)

    Who published the book “Origin of species by Natural Selection” in 1859?

  • 3)

    Which of the following was the contribution of Hugo de Vries?

  • 4)

    The wings of birds and butterflies is an example of

  • 5)

    The phenomenon of “ Industrial Melanism” demonstrates

12th Standard Biology English Medium Zoology - Molecular Genetics 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List the salient features of classical concept of gene.

  • 2)

    Explain the properties of genetic material.

  • 3)

    Explain the process of DNA replication in eukaryotes.

  • 4)

    List the salient features of genetic code.

  • 5)

    Explain how mutation can impact genetic code with an example

12th Standard Biology English Medium Zoology - Molecular Genetics 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Why the human genome project is called a mega project?

  • 2)

    What are the three structural differences between RNA and DNA?

  • 3)

    a) Identify the figure given below
    b) Redraw the structure as a replicating fork and label the parts
    c) Write the source of energy for this replication and name the enzyme involved in this process.
    d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.

  • 4)

    How is the two stage process of protein synthesis advantageous?

  • 5)

    Why did Hershey and Chase use radioactively labelled phosphorous and sulphur only? Would they have got the same result if they use radiolabelled carbon and nitrogen?

12th Standard Biology English Medium Zoology - Molecular Genetics 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Mention any 3 rules as defined by classical concept of gene

  • 2)

    State one gene one enzyme hypothesis

  • 3)

    Differentiate DNA and RNA.

  • 4)

    Distinguish replication and transcription.

  • 5)

    What is initiation complex in transcription?

12th Standard Biology English Medium Zoology - Molecular Genetics 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate - Leading stand and lagging strand

  • 2)

    State any three goals of the human genome project.

  • 3)

    In E.coli, three enzymes β- galactosidase, permease and transacetylase are produced in the presence of lactose. Explain why the enzymes are not synthesized in the absence of lactose.

  • 4)

    Distinguish between structural gene, regulatory gene and operator gene

  • 5)

    A low level of expression of lac operon occurs at all the windows for treatment of various genetic disorders. Justify the statement

12th Standard Biology English Medium Zoology - Molecular Genetics 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate between purines and pyrimidines.

  • 2)

    Why is the term nucleic acid used for DNA and RNA?

  • 3)

    What are nucleotides?

  • 4)

    What is base pair rule?

  • 5)

    What does 'RNA world' refer to?

12th Standard Biology English Medium Zoology - Molecular Genetics 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Give reasons: ‘Genetic code is universal’.

  • 2)

    Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

  • 3)

    Differentiate - Template strand and coding strand.

  • 4)

    Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

  • 5)

    From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?

12th Standard Biology English Medium Zoology - Molecular Genetics 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The term gene was coined by ________

  • 2)

    The classical concept of a gene was given by _______.

  • 3)

    One gene one enzyme hypothesis was proposed by Beadle and Tatum based on ________

  • 4)

    Chromosomes were first observed by ________.

  • 5)

    The term nucleic acid was coined by ________.

12th Standard Biology English Medium Zoology - Molecular Genetics 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Hershey and Chase experiment with bacteriophage showed that ______.

  • 2)

    DNA and RNA are similar with respect to _____.

  • 3)

    A mRNA molecule is produced by _____.

  • 4)

    The total number of nitrogenous bases in human genome is estimated to be about _____.

  • 5)

    E. coli cell grown on 15N medium are transferred to 14N medium and allowed to grow for two generations. DNA extracted from these cells is ultracentrifuged in a cesium chloride density gradient. What density distribution of DNA would you expect in this experiment?

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain criss-cross pattern of inheritance with an example. (or) Explain Inheritance of colour blindness.

  • 2)

    Write a note on thalassemia.

  • 3)

    Write a note on allosomal chromosomal abnormalities.

  • 4)

    Discuss the methods adopted for the improvement of human race.

  • 5)

    Write a note on any 2 Mendelian disorders occurring in human beings.

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the genetic basis of ABO blood grouping man.

  • 2)

    How is sex determined in human beings?

  • 3)

    What is male heterogamety?

  • 4)

    Brief about female heterogamety.

  • 5)

    Give an account of genetic control of Rh factor.

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Why are people with O blood group called as universal donors?

  • 2)

    'AB' Blood group individuals are called universal recipients. Justify

  • 3)

    What is null allele?

  • 4)

    How can erythroblasts foetalis be prevented?

  • 5)

    Draw a schematic representation to show ZW - ZZ type of sex determination.

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Why are sex linked recessive characters more common in the male human beings?

  • 2)

    Differentiate Intersexes from Supersexes

  • 3)

    Explain the mode of sex determination in honeybees.

  • 4)

    What are the applications of Karyotyping?

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Mention two measures under negative eugenics

  • 2)

    Mention the symptoms seen in trisomy 13/ Pataus's syndrome.

  • 3)

    What is a syndrome?

  • 4)

    What is Lyon's hypothesis?

  • 5)

    What are Gynandromorphy?

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is haplodiploidy?

  • 2)

    Distinguish between heterogametic and homogametic sex determination systems

  • 3)

    What is Lyonisation?

  • 4)

    What is criss-cross inheritance?

  • 5)

    What are holandric genes?

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The blood group _________ is called universal donor.

  • 2)

    The blood group _________ is called universal recipient.

  • 3)

    The ABO blood group was discovered by ________.

  • 4)

    The inheritance of blood group is determined by multiple alleles as discovered by _________.

  • 5)

    The__________ is called null allele.

12th Standard Biology English Medium Zoology - Principles of Inheritance and Variation 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Haemophilia is more common in males because it is a ______.

  • 2)

    ABO blood group in man is controlled by _____.

  • 3)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

  • 4)

    Which of the following is not correct?

  • 5)

    Which of the following phenotypes in the progeny are possible from the parental combination AxB?

12th Standard Biology English Medium Zoology - Reproductive Health 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain any five techniques of Assisted Reproductive Technology (ART).

  • 2)

    Explain about breast self Examination and Early diagnosis of Cancer.

  • 3)

    Write a note on cervial cancer.

  • 4)

    What is infertility and write its causes.

  • 5)

    What is ART? Explain any two for ART.

12th Standard Biology English Medium Zoology - Reproductive Health 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Describe the major STDs and their symptoms.

  • 2)

    How are STDs transmitted?

  • 3)

    Open Book Assessment
    ‘Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind’ Justify

12th Standard Biology English Medium Zoology - Reproductive Health 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    List Various natural methods of birth control.

  • 2)

    MTP is legalized in our country. Yes or No? why? 

  • 3)

    Write a note on Foetoscope.

  • 4)

    What is lactational amenorrhoea?

  • 5)

    Mention the type of IUDs with example.

12th Standard Biology English Medium Zoology - Reproductive Health 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is amniocentesis? Why a statutory ban is imposed on this technique?

  • 2)

    Select the correct term from the bracket and complete the given branching tree

    (Barriers, Lactational amenorrhoea, CuT, Tubectomy)

  • 3)

    Correct the following statements
    a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT.
    b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT.
    c) Multiload 375 is a hormone releasing IUD.

  • 4)

    Which method do you suggest the couple to have a baby, if the male partner fails to inseminate the female or due to very low sperm count in the ejaculate?

  • 5)

    What are the strategies to be implemented in India to attain total reproductive health?

12th Standard Biology English Medium Zoology - Reproductive Health 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which type of women are benefited by Invitro fertilization?

  • 2)

    What is PCPNDT Act?

  • 3)

    Define birth control.

  • 4)

    What are the characteristics of an ideal contraceptive?

  • 5)

    What is the purpose of barrier method of contraception?

12th Standard Biology English Medium Zoology - Reproductive Health 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Expand the following
    a) ZIFT
    b) ICSI

  • 2)

    Differentiate foeticide and infanticide

  • 3)

    Write the preventive measures of STDs.

12th Standard Biology English Medium Zoology - Reproductive Health 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Select the proper harmonal Composition of oral Contraceptive pills

  • 2)

    In ZIFT technique the zygote is transferred at the stage of ________

  • 3)

    The family planning programme was initiated by India in _____

  • 4)

    In the year ______    india is expected to become the largest country in population size ______

  • 5)

    Sperm remains active for _____ hours in the female reproductive tract

12th Standard Biology English Medium Zoology - Reproductive Health 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 3)

    Identify the correct statements from the following.

  • 4)

    A contraceptive pill prevents ovulation by ______.

  • 5)

    The approach which does not give the defined action of contraceptive is

12th Standard Biology English Medium Zoology - Human Reproduction 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Differentiate Spermatogenesis and oogenesis.

  • 2)

    Describe the structure of a sperm. (or) Describe the structure of human sperm with a neat labelled diagram.

  • 3)

    Explain the process of fertilization in human beings.

  • 4)

    Write a note a extra embryonic membranes.

  • 5)

    Describe the structure of human ovary.

12th Standard Biology English Medium Zoology - Human Reproduction 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Explain the various phases of the menstrual cycle.

  • 2)

    The following is the illustration of the sequence of ovarian events (a-i) in a human female.

    a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents.
    b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events.
    c) Explain the changes that occurs in the uterus simultaneously in anticipation.
    d) Write the difference between C and H.

12th Standard Biology English Medium Zoology - Human Reproduction 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is Morula?

  • 2)

    What is the function of Sertoli cells?

  • 3)

    What is the role of FSH & LH in spermatogenesis?

  • 4)

    What is acrosome?

  • 5)

    What is LH surge?

12th Standard Biology English Medium Zoology - Human Reproduction 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    How is polyspermy avoided in humans?

  • 2)

    What is colostrum? Write its significance.

  • 3)

    Mention the importance of the position of the testes in humans.

  • 4)

    What is the composition of semen?

  • 5)

    Describe the structure of the human ovum with a neat labelled diagram.

12th Standard Biology English Medium Zoology - Human Reproduction 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Name the Cells noticed in the epithelial layer of Seminiferous tubules.

  • 2)

    Define Gametogenesis.

  • 3)

    Define Insemination.

  • 4)

    Define fertilisation.

  • 5)

    Define Cleavage.

12th Standard Biology English Medium Zoology - Human Reproduction 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Mention the differences between spermiogenesis and spermatogenesis

  • 2)

    At what stage of development are the gametes formed in new born male and female?

  • 3)

    Expand the acronyms
    a. FSH
    b. LH
    c. hCG
    d. hPL

  • 4)

    Placenta is an endocrine tissue. Justify

  • 5)

    Draw a labeled sketch of a spermatozoan.

12th Standard Biology English Medium Zoology - Human Reproduction 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Which one of the following menstrual irregularities is correctly matched?

  • 2)

    Identify the correct Sequence of reproductive events in human beings.

  • 3)

    Spermatid \(\overset { A }{ \rightarrow }\) Spermatozoa what does 'A' stands for?

  • 4)

    Assertion (A): The acrosome of the Sperm cell contains Sperm lysin.
    Reason (R): Sperm lysin destroys the deformed Sperm cells.

  • 5)

    _____ are endocrine cells.

12th Standard Biology English Medium Zoology - Human Reproduction 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    The mature sperms are stored in the ____.

  • 2)

    The male sex hormone testosterone is secreted from _____.

  • 3)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 4)

    The male homologue of the female clitoris is ______.

  • 5)

    The site of embryo implantation is the _____.

12th Standard Biology English Medium Zoology - Reproduction in Organisms 5 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Write a note on regeneration.

  • 2)

    Explain parthenogenesis.

  • 3)

    Write notes on binary fission in animals.

  • 4)

    Describe the regeneration process noticed in living organism.

  • 5)

    Given an account on following terms.
    (a) Hologamy
    (b) Isogamy
    (c) Anisogamy
    (d) Merogamy
    (e) Paedogamy

12th Standard Biology English Medium Zoology - Reproduction in Organisms 5 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Give reasons for the following:
    (a) Some organisms like honey bees are called parthenogenetic animals
    (b) A male honey bee has 16 chromosomes where as its female has 32 chromosomes

  • 2)

    Differentiate between the following:
    (a) Binary fission in amoeba and multiple fission in Plasmodium
    (b) Budding in yeast and budding in Hydra
    (c) Regeneration in lizard and Planaria

12th Standard Biology English Medium Zoology - Reproduction in Organisms 3 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Why are the offsprings of oviparous animal at a greater risk as compared to offsprings of viviparous organisms?

  • 2)

    What is asexual reproduction?

  • 3)

    What is repeated fission?

  • 4)

    Explain multiple fission in plasmodium.

  • 5)

    Explain encystment in amoeba.

12th Standard Biology English Medium Zoology - Reproduction in Organisms 3 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    What is parthenogenesis? Give two examples from animals.

  • 2)

    Which type of reproduction is effective -Asexual or sexual and why?

  • 3)

    The unicellular organisms which reproduce by binary fission are considered immortal. Justify

12th Standard Biology English Medium Zoology - Reproduction in Organisms 2 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Name the types of fission.

  • 2)

    What is peculiar about the cell division of paramecium?

  • 3)

    What is plasmotomy?

  • 4)

    What are exogenous buds?

  • 5)

    Define regeneration mention the types.

12th Standard Biology English Medium Zoology - Reproduction in Organisms 2 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Name an organism where cell division is itself a mode of reproduction.

  • 2)

    Name the phenomenon where the female gamete directly develops into a new organism with an avian example.

  • 3)

    Why is the offspring formed by asexual reproduction referred as a clone?

  • 4)

    How is juvenile phase different from reproductive phase?

  • 5)

    What is the difference between syngamy and fertilization?

12th Standard Biology English Medium Zoology - Reproduction in Organisms 1 Mark Creative Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    Transverse Binary fission is seen is ______

  • 2)

    In, dinoflagellates the types of asexual reproduction seen is _____

  • 3)

    Multiple fission is seen in _______

  • 4)

    Plasmotomy is observed in ________

  • 5)

    Giant Amoeba refers to ______

12th Standard Biology English Medium Zoology - Reproduction in Organisms 1 Mark Book Back Question Paper and Answer Key 2022 - 2023 - by Study Materials View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Animals giving birth to young ones:

  • 3)

    The mode of sexual reproduction in bacteria is by ______.

  • 4)

    In which mode of reproduction variations are seen _____.

12th Standard English Medium Biology Reduced Syllabus Annual Exam Model Question Paper with Answer key - 2021 - by Question Bank Software View & Read

  • 1)


    Identify the correct option to label the diagram Identify the structure
    1- Immature proglottids
    2 - Gravid proglottids
    3 - Scolex
    4 - Mature proglottids
    5 - Neck

  • 2)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375
  • 3)

    Semi-conservative model of replication was proved by _________

  • 4)

    Modern man belongs to which period?

  • 5)

    _________is used for recycling of PET plastics

12th Standard English Medium Biology Reduced Syllabus Annual Exam Model Question Paper - 2021 - by Question Bank Software View & Read

  • 1)

    ______ is a seasonal breeder.

  • 2)

    Identify the correct statements from the following.

  • 3)

    Which is NOT a part of transcription unit?

  • 4)

    The Neanderthal man had the brain capacity of

  • 5)

    What gases are produced in anaerobic sludge digesters?

12th Standard English Medium Biology Reduced Syllabus Public Exam Model Question Paper with Answer key - 2021 - by Question Bank Software View & Read

  • 1)

    Pick out the organism whose fertilization occurs internally

  • 2)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 3)

    _______is unique for DNA.

  • 4)

    The golden age of reptiles was

  • 5)

    Plants used for bio-diesel production________

12th Standard English Medium Biology Reduced Syllabus Public Exam Model Question Paper - 2021 - by Question Bank Software View & Read

  • 1)

    Which among the following animals exhibit ovoviviparity?

  • 2)

    The approach which does not give the defined action of contraceptive is

  • 3)

    Which of the following mRNA yields 6 amino acids after translation?

  • 4)

    A population will not exist in Hardy- Weinberg equilibrium if

  • 5)

    Yamuna Action Plan was a bilateral project signed between ________________

12th Standard English Medium Biology Reduced Syllabus Creative Five mark Question with Answer key - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    Describe the regeneration process noticed in living organism.

  • 2)

    Describe the spermatogenesis with diagram.

  • 3)

    What are IUD's? Explain its way of functioning. Also describe their types.

  • 4)

    Explain in detail about Erythroblastosis foetalis.

  • 5)

    List the salient features of genetic code.

12th Standard English Medium Biology Reduced Syllabus Creative Three mark Question with Answer key - 2021(Public Exam) - by Question Bank Software View & Read

  • 1)

    Differentiate exogenous and endogenous budding.

  • 2)

    How does budding occurs is hydra?

  • 3)

    What is Incomplete parthenogenesis? Explain with example.

  • 4)

    What is the function of Sertoli cells?

  • 5)

    What are Braxter-Hick's contractions?

12th Standard English Medium Biology Reduced Syllabus Creative Two mark Question with Answer key - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    Define regeneration mention the types.

  • 2)

    What is Placentation?

  • 3)

    In females a oogonia forms a single ovum only. What is the significance of the oogonia undergoing meiosis I & II when in a male, each spematogonia forms 4 sperms .

  • 4)

    Name two sexually transmitted infections and their casual agent.

  • 5)

    Explain the inheritance pattern of V-linked genes with example

12th Standard English Medium Biology Reduced Syllabus Creative One mark Question with Answer key - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    During favourable conditions ______ shows multiple fission.

  • 2)

    Regeneration is not seen in ______

  • 3)

    ______ is a seasonal breeder.

  • 4)

    In honey bees, the unfertilized egg produces

  • 5)

    Fusion of morphologically and physiologically similar gametes is called ______

12th Standard English Medium Biology Reduced Syllabus Five mark Important Questions with Answer key - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    Differentiate between the following:
    (a) Binary fission in amoeba and multiple fission in Plasmodium
    (b) Budding in yeast and budding in Hydra
    (c) Regeneration in lizard and Planaria

  • 2)

    The following is the illustration of the sequence of ovarian events (a-i) in a human female.

    a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents.
    b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events.
    c) Explain the changes that occurs in the uterus simultaneously in anticipation.
    d) Write the difference between C and H.

  • 3)

    Amniocentesis, the foetal sex determination test, is banned in our country, Is it necessary? Comment.

  • 4)

    Comment on the methods of Eugenics.

  • 5)

    It is established that RNA is the first genetic material. Justify giving reasons.

12th Standard English Medium Biology Reduced Syllabus Five mark Important Questions - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    What is the difference between syngamy and fertilization?

  • 2)

    Explain the role of oxytocin and relaxin in parturition and lactation.

  • 3)

    The procedure of GIFT involves the transfer of female gametes into the fallopain tube, can gametes be transferred to the uterus to achieve the same result? Explain.

  • 4)

    Explain the inheritance of sex linked characters in human being.

  • 5)

    If the coding sequence in a transcription unit is written as follows:
    5' TGCATGCATGCATGCATGCATGCATGC 3' Write down the sequence of mRNA?

12th Standard English Medium Biology Reduced Syllabus Three mark Important Questions with Answer key - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    Differentiate foeticide and infanticide

  • 2)

    Who disproved Lamarck’s Theory of acquired characters? How?

  • 3)

    What are DNA vaccines?

  • 4)

    Why do we find a decrease in biodiversity distribution, if we move from the tropics towards the poles?

  • 5)

    Write a brief note on Habitat fragmentation.

12th Standard English Medium Biology Reduced Syllabus Three mark Important Questions - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    Give reasons for the following:
    (a) Some organisms like honey bees are called parthenogenetic animals
    (b) A male honey bee has 16 chromosomes where as its female has 32 chromosomes

  • 2)

    What is strobilation?

  • 3)

    Explain briefly on the nature of Ovovivipary.

  • 4)

    What is LH surge?

  • 5)

    Name the absorbents or materials used to manage menstruation.

12th Standard English Medium Biology Reduced Syllabus Two mark Important Questions with Answer key - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    Name an organism where cell division is itself a mode of reproduction.

  • 2)

    What are exogenous buds?

  • 3)

    What is paedogenesis?

  • 4)

    Repeated fission is a type of multiple fission. Yes or No? Why?

  • 5)

    Name the types of cells found in seminiferous tubule.

12th Standard English Medium Biology Reduced Syllabus Two mark Important Questions - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    What is parthenogenesis? Give two examples from animals.

  • 2)

    Define hologamy.

  • 3)

    Why asexual reproduction known as somatogenic reproduction?

  • 4)

    What is colostrum? Write its significance.

  • 5)

    Define fertilisation.

12th Standard English Medium Biology Reduced Syllabus One mark Important Questions with Answer key - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    The foetal membrane that forms the basis of the umbilical cord is _____.

  • 2)

    Find the wrongly matched pair.

  • 3)

    Identify the correct statements from the following.

  • 4)

    Haemophilia is more common in males because it is a ______.

  • 5)

    Which of the following phenotypes in the progeny are possible from the parental combination AxB?

12th Standard English Medium Biology Reduced Syllabus One mark Important Questions - 2021(Public Exam ) - by Question Bank Software View & Read

  • 1)

    The mode of sexual reproduction in bacteria is by ______.

  • 2)

    Multiple fission is seen in _______

  • 3)

    Paramecium and planaria show _____ types of division during asexual reproduction

  • 4)

    ______ refers to the fusion of small sized, morphologically different gametes.

  • 5)

    Which among the following animal is not a continuous breeder?

12th Standard Bio-Zoology English Medium Environmental Issues Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    The Ozone Day is observed every year on September 16 as on this day in 1987 the ___________was signed for launching efforts to arrest the depletion of the fragile ozone layer in the stratosphere that prevents the harmful ultra-violet rays of the sun from reaching the earth. Fill the correct word in blank.

  • 2)

    SMOG is derived from:

  • 3)

    Excess of fluoride in drinking water causes:

  • 4)

    Incineration is the best method to dispose ____________

  • 5)

    The 2018 UN climate change conference was held in ___________

12th Standard Bio-Zoology English Medium Environmental Issues Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    With which of the following, the Agenda 21’ of Rio Summit, 1992 is related to?

  • 2)

    Which among the following awards instituted by the Government of India for individuals or communities from rural areas that have shown extraordinary courage and dedication in protecting Wildlife?

  • 3)

    Which among the following always decreases in a Food chain across tropic levels?

  • 4)

    In the E- waste generated by the Mobile Phones, which among the following metal is most abundant?

  • 5)

    Oil spills can lead to ________________

12th Standard Bio-Zoology English Medium Biodiversity and its Conservation Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Who introduced the term biodiversity?

  • 2)

    Which one of the following are at high risk extinction due to habitat destruction?

  • 3)

    There are ________ mega biodiversity countries in the world

  • 4)

    The grizzled squirrel and lion tailed Macaque are endemic to _____________

  • 5)

    ___________ is a biographical gateway for much of India's flora and fauna.

12th Standard Bio-Zoology English Medium Biodiversity and its Conservation Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    The Species-Area relationship was given by ___________

  • 2)

    ___________ is not a exotic species.

  • 3)

    Death of _____________ population is attributed to the medicine Diclofenac.

  • 4)

    The red data book is maintained by ____________

  • 5)

    Red list has _____________ categories.

12th Standard Bio-Zoology English Medium Organisms and Populations Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    The interaction in nature, where one gets benefit on the expense of other is...

  • 2)

    Match the following and choose the correct combination from the options given below.

    Column I Column II
    A. Mutalism 1. Lion and deer
    B. Commensalism 2. Round worm and man
    C. Parasitism 3. Birds compete with squirrels for nuts
    D. Competition 4. Sea anemone on hermit crab
    E. Predation 5. Barnacles attached to Whales.
  • 3)

    The figure given below is a diagrammatic representation of response of organisms to abiotic factors. What do A, B and C represent respectively.

  • 4)

    Which of the following is correct for r-selected species

  • 5)

    Nuts are eaten by birds and squirrels. This is an example of an interaction called _____________

12th Standard Bio-Zoology English Medium Organisms and Populations Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is an r-species

  • 2)

    Match the following and choose the correct combination from the options given below.

    Column I Column II
    A. Mutalism 1. Lion and deer
    B. Commensalism 2. Round worm and man
    C. Parasitism 3. Birds compete with squirrels for nuts
    D. Competition 4. Sea anemone on hermit crab
    E. Predation 5. Barnacles attached to Whales.
  • 3)

    Which of the following is correct for r-selected species

  • 4)

    Animals that can move from fresh water to sea called as______

  • 5)

    "Birds and mammals attain greater body size in colder regions than warmer regions." - Choose the correct option.

12th Standard Bio-Zoology English Medium Applications of Biotechnology Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Which one of the following statements is true regarding DNA polymerase used in PCR?

  • 2)

    ELISA is mainly used for

  • 3)

    Vaccines that use components of a pathogenic organism rather than the whole organism are called

  • 4)

    Insulin was first isolated by_______

  • 5)

    Best and Banting isolated insulin from pancreatic islets of___________

12th Standard Bio-Zoology English Medium Applications of Biotechnology Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Dolly, the sheep was obtained by a technique known as

  • 2)

    Transgenic animals are those which have

  • 3)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

  • 4)

    Vaccines that use components of a pathogenic organism rather than the whole organism are called

  • 5)

    Interferons are produced using________

12th Standard Bio-Zoology English Medium Microbes in Human Welfare Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following bacteria is used extensively as a bio-pesticide?

  • 2)

    Which of the following is not involved in nitrogen fixation?

  • 3)

    The enzyme________is got from Aspergillus.

  • 4)

    ________is not used as a biofertilizer

  • 5)

    Biofertilizers are not involved in this process

12th Standard Bio-Zoology English Medium Microbes in Human Welfare Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following pair is correctly matched for the product produced by them?

  • 2)

    CO2 is not released during

  • 3)

    The purpose of biological treatment of waste water is to _______

  • 4)

    WorId Biofuel day is observed on_______

  • 5)

    Aspergillus niger helps to produce________

12th Standard Bio-Zoology English Medium Human Health and Diseases Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Cirrhosis of liver is caused by chronic intake of ______

  • 2)

    The sporozoite of the malarial parasite is present in ______

  • 3)

    Spread of cancerous cells to distant sites is termed as

  • 4)

    The site of infection for yersinia pestis is___________

  • 5)

    ___________is a pandemic disease

12th Standard Bio-Zoology English Medium Human Health and Diseases Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    A 30 year old woman has bleedy diarrhoea for the past 14 hours, which one of the following organisms is likely to cause this illness?

  • 2)

    Paratope is an

  • 3)

    Allergy involves

  • 4)

    Rigidity of the Jaw muscle is a symptom of__________

  • 5)

    The site of infection for yersinia pestis is___________

12th Standard Bio-Zoology English Medium Evolution Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

  • 2)

    Which of the following is the correct sequence of event with reference to the central dogma?

  • 3)

    Which of the following statements about DNA replication is not correct?

  • 4)

    Which of the following statements is not true about DNA replication in eukaryotes?

  • 5)

    An operon is a: ______.

12th Standard Bio-Zoology English Medium Evolution Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Who published the book “Origin of species by Natural Selection” in 1859?

  • 2)

    Fossils are generally found in

  • 3)

    Evolutionary history of an organism is called

  • 4)

    Which period was called “Age of fishes”?

  • 5)

    The Neanderthal man had the brain capacity of

12th Standard Bio-Zoology English Medium Molecular Genetics Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    DNA and RNA are similar with respect to _____.

  • 2)

    The first codon to be deciphered was ______ which codes for ________.

  • 3)

    When lactose is present in the culture medium:

  • 4)

    The term gene was coined by ________

  • 5)

    Griffith's experiments proved that _________.

12th Standard Bio-Zoology English Medium Molecular Genetics Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    DNA and RNA are similar with respect to _____.

  • 2)

    A mRNA molecule is produced by _____.

  • 3)

    Which of the following statements is not true about DNA replication in eukaryotes?

  • 4)

    The first codon to be deciphered was ______ which codes for ________.

  • 5)

    Chromosomes were first observed by ________.

12th Standard Bio-Zoology English Medium Principles Of Inheritance and Variation Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Haemophilia is more common in males because it is a ______.

  • 2)

    What can be the blood group of offspring when both parents have AB blood group?

  • 3)

    If the childs blood group is ‘O’ and fathers blood group is ‘A’ and mother’s blood group is ‘B’ the genotype of the parents will be ______.

  • 4)

    Down's syndrome is a genetic disorder which is caused by the presence of an extra chromosome number _____.

  • 5)

    “Universal Donor” and “Universal Recipients” blood group are _____and_______respectively

12th Standard Bio-Zoology English Medium Principles Of Inheritance and Variation Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    ABO blood group in man is controlled by _____.

  • 2)

    XO type of sex determination and XY type of sex determination are examples of ______.

  • 3)

    Pataus syndrome is also referred to as ______.

  • 4)

    The inheritance of blood group is determined by multiple alleles as discovered by _________.

  • 5)

    XX - XO type of sex determination is in ______.

12th Standard Bio-Zoology English Medium Reproductive Health Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    The approach which does not give the defined action of contraceptive is

  • 3)

    Read the given statements and select the correct option.
    Statement 1: Diaphragms, cervical caps and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

  • 4)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 5)

    The family planning programme was initiated by India in _____

12th Standard Bio-Zoology English Medium Reproductive Health Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 3)

    Identify the correct statements from the following.

  • 4)

    The family planning programme was initiated by India in _____

  • 5)

    The incubation period for _____ can be more than 10 years.

12th Standard Bio-Zoology English Medium Human Reproduction Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Colostrum is rich in ______.

  • 2)

    The Androgen Binding Protein (ABP) is produced by ________.

  • 3)

    Assertion(A): Head of the sperm consists of acrosome and mitochondria.
    Reason(R): Acrosome contains spiral rows of mitochondria.
    Codes:
    (a) A and R are true, R is the correct explanation of A.
    (b) A and R are true, R is not the correct explanation of A.
    (c)  A is true, R is false.
    (d) Both A and R are false.

  • 4)

    ____ is not linked to male reproductive system.

  • 5)

    ______ cells nourish the sperms.

12th Standard Bio-Zoology English Medium Human Reproduction Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    The mature sperms are stored in the ____.

  • 2)

    The most important hormone in intiating and maintaining lactation after birth is ______.

  • 3)

    Mammalian egg is ______.

  • 4)

    The milk secreted by the mammary glands soon after child birth is called ______.

  • 5)

    Colostrum is rich in ______.

12th Standard Bio-Zoology English Medium Reproduction in Organisms Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 3)

    Transverse Binary fission is seen is ______

  • 4)

    Regeneration is not seen in ______

  • 5)

    If the entire organism behaves as a gamete the Phenomenon is called _____

12th Standard Bio-Zoology English Medium Reproduction in Organisms Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    The mode of sexual reproduction in bacteria is by ______.

  • 2)

    Multiple fission is seen in _______

  • 3)

    During favourable conditions ______ shows multiple fission.

  • 4)

    Regeneration is not seen in ______

  • 5)

    Autogamy is seen in ______

12th Standard Bio-Botany English Medium Economically useful Plants Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Consider the following statements and choose the right option.
    i) Cereals are members of grass family.
    ii) Most of the food grains come from monocotyledon.

  • 2)

    Tectona grandis is coming under family _____.

  • 3)

    New world species of cotton _____.

  • 4)

    Assertion: Turmeric fights various kinds of cancer
    Reason: Curcumin is an anti-oxidant present in turmeric

  • 5)

    Find out the correctly matched pair.

12th Standard Bio-Botany English Medium Economically useful Plants Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Consider the following statements and choose the right option.
    i) Cereals are members of grass family.
    ii) Most of the food grains come from monocotyledon.

  • 2)

    Tamarindus indica is indigenous to _____.

  • 3)

    New world species of cotton _____.

  • 4)

    Observe the following statements and pick out the right option from the following:
    Statement I: The drug sources of Siddha include plants, animal parts, ores and minerals.
    Statement II: Minerals are used for preparing drugs with long shelf-life.

  • 5)

    The only cereal that has originated and domesticated from the New world.

12th Standard Bio-Botany English Medium Plant Breeding Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Assertion(A): Genetic variation provides the raw material for selection
    Reason(R): Genetic variations are differences in genotypes of the individuals.

  • 2)

    The quickest method of plant breeding is _______.

  • 3)

    Desired improved variety of economically useful crops are raised by _______.

  • 4)

    Dwarfing gene of wheat is ______.

  • 5)

    Crosses between the plants of the same variety are called ____.

12th Standard Bio-Botany English Medium Plant Breeding Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Match Column I with Column II

    Column I Column II
    i) William S. Gaud I) Heterosis
    ii) Shull II) Mutation breeding
    iii) Cotton Mather III) Green revolution
    iv) Muller and Stadler IV) Natural hybridization
  • 2)

    Importing better varieties and plants from outside and acclimatising them to local environment is called _____.

  • 3)

    Which one of the following crop varieties correct matches with its resistance to a disease?

  • 4)

    ________is the process of bringing a plant species under human control.

  • 5)

    Arbuscular mycorrhizae is a symbiotic association between ____________

12th Standard Bio-Botany English Medium Environmental Issues Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Depletion of which gas in the atmosphere can lead to an increased incidence of skin cancer?

  • 2)

    One green house gas contributes 14% of total global warming and another contributes 6%. These are respectively identified as _____.

  • 3)

    Deforestation does not lead to _____.

  • 4)

    The plants which are grown in silivpasture system are ______.

  • 5)

    ___________ is not a method of waste water treatment.

12th Standard Bio-Botany English Medium Environmental Issues Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following would most likely help to slow down the greenhouse effect.

  • 2)

    With respect to Eichhornia
    Statement A: It drains off oxygen from water and is seen growing in standing water.
    Statement B: It is an indigenous species of our country.

  • 3)

    One green house gas contributes 14% of total global warming and another contributes 6%. These are respectively identified as _____.

  • 4)

    The unit for measuring ozone thickness _____.

  • 5)

    People’s movement for the protection of environment in Sirsi of Karnataka is ______.

12th Standard Bio-Botany English Medium Ecosystem Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is / are not a natural ecosystem?

  • 2)

    Which of the following ecosystem has the highest primary productivity?

  • 3)

    Which one is in descending order of a food chain?

  • 4)

    Significance of food web is / are ______.

  • 5)

    Which of the following is not a sedimentary cycle

12th Standard Bio-Botany English Medium Ecosystem Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is not a abiotic component of the ecosystem?

  • 2)

    Which of the following ecosystem has the highest primary productivity?

  • 3)

    The following diagram represents

     

  • 4)

    Which of the following are not regulating services of ecosystem services
    i) Genetic resources
    ii) Recreation and aesthetic values
    iii) Invasion resistance
    iv) Climatic regulation

  • 5)

    Identify the incorrect option among the following component sequence.

12th Standard Bio-Botany English Medium Principles Of Ecology Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Ecology is the study of an individual species is called
    i) Community ecology
    ii) Autecology
    iii) Species ecology
    iv) Synecology

  • 2)

    Read the given statements and select the correct option.
    i) Loamy soil is best suited for plant growth as it contains a mixture of silt, sand and clay.
    ii) The process of humification is slow in case of organic remains containing a large amount of lignin and cellulose.
    iii) Capillary water is the only water available to plant roots as it is present inside the micropores.
    iv) Leaves of shade plant have more total chlorophyll per reaction centre, low ratio of chl a and chl b are usually thinner leaves.

  • 3)

    In soil water available for plants is ____.

  • 4)

    Read the following statements and fill up the blanks with correct option.
    i) Total soil water content in soil is called ______
    ii) Soil water not available to plants is called _______
    iii) Soil water available to plants is called _____.

  • 5)

    Ophrys an orchid resembling the female of an insect so as to able to get pollinated is due to phenomenon of ______.

12th Standard Bio-Botany English Medium Principles Of Ecology Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Arrange the correct sequence of ecological hierarchy starting from lower to higher level.

  • 2)

    A specific place in an ecosystem, where an organism lives and performs its functions is _____.

  • 3)

    Read the given statements and select the correct option.
    i) Hydrophytes possess aerenchyma to support themselves in water.
    ii) Seeds of Viscum are positively photoblastic as they germinate only in presence of light.
    iii) Hygroscopic water is the only soil water available to roots of plant growing in soil as it is present inside the micropores.
    iv) High temperature reduces use of water and solute absorption by roots

  • 4)

    Which of the given plant produces cardiac glycosides?

  • 5)

    Read the given statements and select the correct option.
    i) Loamy soil is best suited for plant growth as it contains a mixture of silt, sand and clay.
    ii) The process of humification is slow in case of organic remains containing a large amount of lignin and cellulose.
    iii) Capillary water is the only water available to plant roots as it is present inside the micropores.
    iv) Leaves of shade plant have more total chlorophyll per reaction centre, low ratio of chl a and chl b are usually thinner leaves.

12th Standard Bio-Botany English Medium Plant Tissue Culture Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    The time duration for sterilization process by using autoclave is ______ minutes and the temperature is ______.

  • 2)

    Which of the following statement is correct

  • 3)

    Select the incorrect statement from given statement.

  • 4)

    Virus free plants are developed from _____.

  • 5)

    The prevention of large scale loss of biological interity ____.

12th Standard Bio-Botany English Medium Plant Tissue Culture Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Virus free plants are developed from _____.

  • 2)

    Cryopreservation means it is a process to preserve plant cells, tissues or organs _____.

  • 3)

    Identify the group of scientists who developed the intergenic hybrid - the pomato.

  • 4)

    The production of secondary metabolites require the use of _________.

  • 5)

    Protoplast are the cells devoid of ___________

12th Standard Bio-Botany English Medium principles and processes of Bio-technology Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Plasmids are ______.

  • 2)

    Consider the following statements:
    I. Recombinant DNA technology is popularly known as genetic engineering is a stream of biotechnology which deals with the manipulation of genetic materials by man invitro
    II. pBR322 is the first artificial cloning vector developed in 1977 by Boliver and Rodriguez from E.coli plasmid
    III. Restriction enzymes belongs to a class of enzymes called nucleases.
    Choose the correct option regarding above statements

  • 3)

    The process of recombinant DNA technology has the following steps
    I. amplication of the gene
    II. Insertion of recombinant DNA into the host cells
    III. Cutting of DNA at specific location using restriction enzyme .
    IV. Isolation of genetic material (DNA) Pick out the correct sequence of step for recombinant DNA technology.

  • 4)

    Which one of the following palindromic base sequence in DNA can be easily cut at about the middle by some particular restriction enzymes?

  • 5)

    Which of the following one is used as a Biosensors?

12th Standard Bio-Botany English Medium principles and processes of Bio-technology Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Consider the following statements:
    I. Recombinant DNA technology is popularly known as genetic engineering is a stream of biotechnology which deals with the manipulation of genetic materials by man invitro
    II. pBR322 is the first artificial cloning vector developed in 1977 by Boliver and Rodriguez from E.coli plasmid
    III. Restriction enzymes belongs to a class of enzymes called nucleases.
    Choose the correct option regarding above statements

  • 2)

    In which techniques Ethidium Bromide is used?

  • 3)

    Assertion (A): Agrobacterium tumifaciens is popular in genetic engineering because this bacterium is associated with the root nodules of all cereals and pulse crops
    Reason(R): A gene incorporated in the bacterial chromosomal genome gets automatically transferred to the cross with which bacterium is associated.

  • 4)

    Which one of the following is not correct statement

  • 5)

    An analysis of chromosomal DNA using the southern hybridisation technique does not use _____.

12th Standard Bio-Botany English Medium Chromosomal Basis of Inheritance Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    An allohexaploidy contains ______.

  • 2)

    Match list I with list II

    List I list II
    A. A pair of chromosomes extra with diploid i) monosomy
    B. One chromosome extra to the diploid ii) tetrasomy
    C. One chromosome loses from diploid iii) trisomy
    D.Two individual chromosomes lose from diploid

    iv) double monosomy

  • 3)

    Accurate mapping of genes can be done by three point test cross because increases _____.

  • 4)

    Genes G S L H are located on same chromosome. The recombination percentage is between L and G is 15%, S and L is 50%, H and S are 20%. The correct order of genes is _____.

  • 5)

    If haploid number in a cell is 18. The double monosomic and trisomic number will be _____.

12th Standard Bio-Botany English Medium Chromosomal Basis of Inheritance Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    The A and B genes are 10 cm apart on a chromosome. If an AB/ab heterozygote is testcrossed to ab/ab, how many of each progeny class would you expect out of 100 total progeny?

  • 2)

    Accurate mapping of genes can be done by three point test cross because increases _____.

  • 3)

    Due to incomplete linkage in maize, the ratio of parental and recombinants are ______.

  • 4)

    How many map units separate two alleles A and B if the recombination frequency is 0.09?

  • 5)

    Which is not a feature of the chromosomal theory of inheritance?

12th Standard Bio-Botany English Medium Classical Genetics Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in _____.

  • 2)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 3)

    The epistatic effect, in which the dihybrid cross 9:3:3:1 between AaBb Aabb is modified as ______.

  • 4)

    In a test cross involving F1 dihybrid flies, more parental type offspring were produced than the recombination type offspring. This indicates ______.

  • 5)

    The genes controlling the seven pea characters studied by Mendel are known to be located on how many different chromosomes?

12th Standard Bio-Botany English Medium Classical Genetics Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in _____.

  • 2)

    Which one of the following is an example of polygenic inheritance?

  • 3)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 4)

    Fruit colour in squash is an example of ______.

  • 5)

    Gene which suppresses other genes activity but does not lie on the same locus is called as _____.

12th Standard Bio-Botany English Medium Asexual and Sexual Reproduction in plants Reduced Syllabus Important Questions With Answer Key 2021 - by Question Bank Software View & Read

  • 1)

    Arrange the layers of anther wall from locus to periphery

  • 2)

    The genetic ability of a plant cell to produce the entire plant is said to be ________________

  • 3)

    Which is not a part of mature seed?

  • 4)

    Which of the following characters does not exist in Ornithophilous flowers?

  • 5)

    Generally, the pollen grains are liberated from another at ___________

12th Standard Bio-Botany English Medium Asexual and Sexual Reproduction in plants Reduced Syllabus Important Questions 2021 - by Question Bank Software View & Read

  • 1)

    Choose the correct statement from the following

  • 2)

    Match the following

    I) External fertilization i) pollen grain
    II) Androecium ii) anther wall
    III) Male gametophyte iii) algae
    IV) Primary parietal layer iv) stamens
  • 3)

    Transmitting tissue is found in ______.

  • 4)

    Consider the following statement(s)
    i) In Protandrous flowers pistil matures earlier
    ii) In Protogynous flowers pistil matures earlier
    iii) Herkogamy is noticed in unisexual flowers
    iv) Distyly is present in Primula

  • 5)

    Cleavage polyembryony is noticed in _________________

12th Standard Biology English Medium Reduced Syllabus Model Question paper with Answer key - 2021 Part - 2 - by Question Bank Software View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    Budding is seen in ______

  • 3)

    A few statements with regard to sexual reproduction are given below:
    i. Sexual reproduction does not always require two individuals
    ii. Sexual reproduction generally involves gametic fusion
    iii. Meiosis never occurs during sexual reproduction
    iv. External fertilization is a rule during sexual reproduction
    Choose the correct statements from the options below:

  • 4)

    The male sex hormone testosterone is secreted from _____.

  • 5)

    Assertion(A): Ovulation is the release of ovum from the Graafian follicle.
    Reason(R): It occurs during the follicular phase of the menstrual cycle.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

12th Standard Biology English Medium Reduced Syllabus Model Question paper with Answer key - 2021 Part - 1 - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A) : In bee society, all the members are diploid except drones.
    Reason (R) : Drones are produced by parthenogenesis
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    In _____ types of natural parthenogenesis only females are produced.

  • 3)

    Assertion (A): Syngamy refers to the fusion of two haploid gametes.
    Reason (R): Syngamy leads to zygote formation.
    Codes:
    A. A and R are correct.
    B. A and R are incorrect.
    C. R is not the right explanation for A
    D. A is correct but R is incorrect

  • 4)

    Assertion(A): In human male, testes are extra abdominal and lie in scrotal sacs.
    Reason(R): Scrotum acts as thermoregulator and keeps temperature lower by 2oC for normal sperm production.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

  • 5)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

12th Standard Biology English Medium Reduced Syllabus Model Question paper - 2021 Part - 2 - by Question Bank Software View & Read

  • 1)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    The site of embryo implantation is the _____.

  • 3)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 4)

    Father of a child is colourblind and mother is carrier for colourblindness, the probability of the child being colourblind is _____.

  • 5)

    DNA and RNA are similar with respect to _____.

12th Standard Biology English Medium Reduced Syllabus Model Question paper - 2021 Part - 1 - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 3)

    Read the given statements and select the correct option.
    Statement 1: Diaphragms, cervical caps and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

  • 4)

    Which of the following is true about Rh factor in the offspring of a parental combination DdxDd (both Rh positive)?

  • 5)

    Down's syndrome is a genetic disorder which is caused by the presence of an extra chromosome number _____.

12th Standard Biology English Medium Reduced Syllabus Important Questions with Answer key - 2021 Part - 2 - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The site of embryo implantation is the _____.

  • 3)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 4)

    If the childs blood group is ‘O’ and fathers blood group is ‘A’ and mother’s blood group is ‘B’ the genotype of the parents will be ______.

  • 5)

    Which of the following is incorrect regarding ZW-ZZ type of sex determination?

12th Standard Biology English Medium Reduced Syllabus Important Questions with Answer key - 2021 Part - 1 - by Question Bank Software View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 3)

    The process which the sperm undergoes before penetrating the ovum is _____.

  • 4)

    Assertion(A): Ovulation is the release of ovum from the Graafian follicle.
    Reason(R): It occurs during the follicular phase of the menstrual cycle.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

  • 5)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

12th Standard Biology English Medium Reduced Syllabus Important Questions - 2021 Part - 2 - by Question Bank Software View & Read

  • 1)

    The whole process of spermatogenesis takes about ______ days.

  • 2)

    Each testis is covered by a fibrous layer _____

  • 3)

    In the year ______    india is expected to become the largest country in population size ______

  • 4)

    Expansion of the RCH is _____

  • 5)

    PCR proceeds in three distinct steps governed by temperature, they are in order of

12th Standard Biology English Medium Reduced Syllabus Important Questions - 2021 Part - 1 - by Question Bank Software View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 3)

    The mature sperms are stored in the ____.

  • 4)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 5)

    The process which the sperm undergoes before penetrating the ovum is _____.

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Transverse Binary fission is seen is ______

  • 3)

    Paedogamy is the sexual union of _____

  • 4)

    A few statements describing certain features of reproduction are given below. Select the options that are true for both sexual and asexual reproduction from the options given:
    (i) Gametic fusion takes place
    (ii) Transfer of genetic material takes place
    (iii) Reduction division takes place
    (iv) Progeny have some resemblance, with parents

  • 5)

    The ______ is the smallest human cell.

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - by Question Bank Software View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    In, dinoflagellates the types of asexual reproduction seen is _____

  • 3)

    Regeneration is not seen in ______

  • 4)

    The male sex hormone testosterone is secreted from _____.

  • 5)

    Testosterone is secreted by ____

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Two - by Question Bank Software View & Read

  • 1)

    The mode of sexual reproduction in bacteria is by ______.

  • 2)

    All the following animals are continuous breeders, except.

  • 3)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 4)

    Identify the correct statements from the following.

  • 5)

    Which of the following phenotypes in the progeny are possible from the parental combination AxB?

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Two - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A) : In bee society, all the members are diploid except drones.
    Reason (R) : Drones are produced by parthenogenesis
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    Ovovivipary is seen in ______

  • 3)

    In _____ types of parthenogenesis egg can develop into individuals of any sex.

  • 4)

    Given below, are a few statements related to external fertilization. Choose the correct statements:
    i. The male and female gametes are formed and released simultaneously
    ii. Only a few gametes are released into the medium
    iii. Water is the medium in a majority of organism exhibiting external fertilization
    iv. Offspring formed as a result of external fertilization have better chance of survival than those formed inside the organism

  • 5)

    The male homologue of the female clitoris is ______.

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Three - by Question Bank Software View & Read

  • 1)

    Evolutionary history of an organism is called

  • 2)

    Allergy involves

  • 3)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

  • 4)

    Which of the following is correct for r-selected species

  • 5)

    The Ozone Day is observed every year on September 16 as on this day in 1987 the ___________was signed for launching efforts to arrest the depletion of the fragile ozone layer in the stratosphere that prevents the harmful ultra-violet rays of the sun from reaching the earth. Fill the correct word in blank.

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Three - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    Assertion (A): Asexual reproduction is called blastogenic reproduction.
    Reason (R): It is accomplished by mitotic and meiotic divisions.
    Codes:
    A. A and R are correct
    B. A is correct but R is incorrect
    C. Both A and R are incorrect
    D. R is the correct explanation for A

  • 3)

    The most important hormone in intiating and maintaining lactation after birth is ______.

  • 4)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 5)

    Which of the following approach does not give the defined action of contraceptive?

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Four - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)


    Identify the correct option to label the diagram Identify the structure
    1- Immature proglottids
    2 - Gravid proglottids
    3 - Scolex
    4 - Mature proglottids
    5 - Neck

  • 3)

    ______ is not linked to polymenorrhoea

  • 4)

    Klinefelters syndrome is characterized by a karyotype of ____.

  • 5)

    A mRNA molecule is produced by _____.

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Four - by Question Bank Software View & Read

  • 1)

    In which mode of reproduction variations are seen _____.

  • 2)

    External fertilization is seen is ______

  • 3)

    Paedogenetic parthenogenesis is seen in ______

  • 4)

    Colostrum is rich in ______.

  • 5)

    This technique is used to diagnose the chromosomal abnormities.

12th Standard Biology English Medium Free Online Test Book Back One Mark Questions - by Question Bank Software View & Read

  • 1)

    Transgenic animals are those which have

  • 2)

    The point mutation sequence for transition, transition, transversion and transversion in DNA are ______.

  • 3)

    Which of the following one is used as a Biosensors?

  • 4)

    Virus free plants are developed from _____.

  • 5)

    A free living nitrogen fixing cyanobacterium which can also form symbiotic association with the water fern Azolla ______.

12th Standard Biology English Medium Free Online Test Book Back 1 Mark Questions with Answer Key - by Question Bank Software View & Read

  • 1)

    Darwin’s finches are an excellent example of

  • 2)

    Which among the following awards instituted by the Government of India for individuals or communities from rural areas that have shown extraordinary courage and dedication in protecting Wildlife?

  • 3)

    Identify the incorrect pair

  • 4)

    Pure tall plants are crossed with pure dwarf plants. In the F1 generation, all plants were tall. These tall plants of F1 generation were selfed and the ratio of tall to dwarf plants obtained was 3:1. This is called ______.

  • 5)

    Which of the following one is used as a Biosensors?

12th Standard Biology English Medium Free Online Test Book Back One Mark Questions - Part Two - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    Find the wrongly matched pair.

  • 3)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375
  • 4)

    Pataus syndrome is also referred to as ______.

  • 5)

    Meselson and Stahl’s experiment proved

12th Standard Biology English Medium Free Online Test Book Back 1 Mark Questions with Answer Key - Part Two - by Question Bank Software View & Read

  • 1)

    Colostrum is rich in ______.

  • 2)

    A contraceptive pill prevents ovulation by ______.

  • 3)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO x IAIB?

  • 4)

    ZW-ZZ system of sex determination occurs in _____.

  • 5)

    Which of the following statements is not true about DNA replication in eukaryotes?

12th Standard Biology English Medium Free Online Test Book Back One Mark Questions - Part Three - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A) : In bee society, all the members are diploid except drones.
    Reason (R) : Drones are produced by parthenogenesis
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    The foetal membrane that forms the basis of the umbilical cord is _____.

  • 3)

    Identify the correct statements from the following.

  • 4)

    Which of the following is not correct?

  • 5)

    Pataus syndrome is also referred to as ______.

12th Standard Biology English Medium Free Online Test Book Back 1 Mark Questions with Answer Key - Part Three - by Question Bank Software View & Read

  • 1)

    Mammalian egg is ______.

  • 2)

    Assertion(A): Ovulation is the release of ovum from the Graafian follicle.
    Reason(R): It occurs during the follicular phase of the menstrual cycle.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

  • 3)

    Assertion (A): Agrobacterium tumifaciens is popular in genetic engineering because this bacterium is associated with the root nodules of all cereals and pulse crops
    Reason(R): A gene incorporated in the bacterial chromosomal genome gets automatically transferred to the cross with which bacterium is associated.

  • 4)

    The prevention of large scale loss of biological interity ____.

  • 5)

    Pedogenesis refers to _____.

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - by Question Bank Software View & Read

  • 1)

    During favourable conditions ______ shows multiple fission.

  • 2)

    Testosterone is secreted by ____

  • 3)

    Assertion (A): IUD's are inserted in the ovary.
    Reason (R): IUD's Increases phagocytosis of the sperm.
    Codes:
    (a) Both A and R are correct
    (b) Both A and R are incorrect
    (c) A is correct R is incorrect
    (d) A is incorrect R is correct

  • 4)

    The ZW - ZZ type of sex determination is seen ________.

  • 5)

    In gypsy moth we find _________ type of sex determination.

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - by Question Bank Software View & Read

  • 1)

    Giant Amoeba refers to ______

  • 2)

    Testosterone is secreted by ____

  • 3)

    This technique is used to diagnose the chromosomal abnormities.

  • 4)

    The gene responsible for ________ is inherited as an autosomal recessive lethal gene in man

  • 5)

    Pick out the odd man out.

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Two - by Question Bank Software View & Read

  • 1)

    In the geom line gene therapy, the genes are introduced into the______

  • 2)

    Statement 1: ADA deficiency was the first disease treated by gene therapy.
    Statement 2: ADA is an autosomal recessive metabolic disorder

  • 3)

    DB is a standard abbreviation  used for the quantitative expression of

  • 4)

    Identify the incorrect statement.
    (i) EcoSan toilets is a sustainable way for handling human excreta by using dry composting toilets
    (ii) It reduces waste water generation
    (Ui) It is based on recovery and recycling of nutrients from excreta
    (iv) EcoSan toilets are used in several parts of India and Srilanka.

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Two - by Question Bank Software View & Read

  • 1)

    The site of infection for yersinia pestis is___________

  • 2)

    Infection of Ascariasis occur due to ___________________

  • 3)

    All the following are recombinant vaccines. Except

  • 4)

    Study the four statements (A to D) given below and select the two correct ones out of them.
    A) A lion eating a deer and a sparrow feeding on grain are ecologically similar in being consumers.
    B) Predator starfish Pisaster helps in maintaining species diversity of some invertebrates.
    C) Predators ultimately lead to the extinction of prey species.
    D) Production of chemicals such as nicotine, strychnine by the plants is disordered.
    The two correct statements are

  • 5)

    Select the proper sequence indicating the increasing order of biodiversity.

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Three - by Question Bank Software View & Read

  • 1)

    Technique used for cultivation of sponges is based on ______

  • 2)

    In _____ types of parthenogenesis egg can develop into individuals of any sex.

  • 3)

    ______ is a berry shaped duster of cells.

  • 4)

    The ruptured Graafian follicle forms ______

  • 5)

    Why is colostrum recommended to new born baby?

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Three - by Question Bank Software View & Read

  • 1)

    Conjugation is seen in _____

  • 2)

    A few statements with regard to sexual reproduction are given below:
    i. Sexual reproduction does not always require two individuals
    ii. Sexual reproduction generally involves gametic fusion
    iii. Meiosis never occurs during sexual reproduction
    iv. External fertilization is a rule during sexual reproduction
    Choose the correct statements from the options below:

  • 3)

    Each testis is covered by a fibrous layer _____

  • 4)

    Which one of the following is not the function of placenta?

  • 5)

    The incubation period for _____ varies between 1-8 months.

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Five - by Question Bank Software View & Read

  • 1)

    Isogamy is observed in ______

  • 2)

    ______ cells nourish the sperms.

  • 3)

    In gypsy moth we find _________ type of sex determination.

  • 4)

    The RNA polymerase of prokaryotes binds with ____________ factor to initiate polymerization.

  • 5)

    Continuous consumption of alcohol affects ___________

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Five - by Question Bank Software View & Read

  • 1)

    Which among the following animals exhibit ovoviviparity?

  • 2)

    Match and select the correct option

    Column I Column II
    a. Proliferative phase 1. Breakdown of endometrium lining
    b. Secretory phase 2. Follicular phase
    c. Menstruation 3. Luteal phase
  • 3)

    Wodd Breast feeding week is observed during.

  • 4)

    In this Assisted Reproductive Technology (ART), the sperms and egg are allowed to united outside the body and then transformed into the woman's uterus.

  • 5)

    ABO blood group is a classical example for __________

12th Standard Biology English Medium Free Online Test Creative One Mark Questions with Answer Key - Part Four - by Question Bank Software View & Read

  • 1)


    Identify the correct option to label the diagram
    1 - Archaeocytes
    2 - Inner membrane
    3 - Micropyle
    4 - Outer membrane
    5 - Monaxonspicules

  • 2)

    Which of the following is not required for any of the techniques of DNA finger printing available at present?

  • 3)

    The process by which organisms with different evolutionary history evolve similar phenotypic adaptations in response to a common environmental challenge is called

  • 4)

    Which of the following is wrongly matched in the given table?

  • 5)

    For transformation, micro-particles coated with DNA to be bombarded with gene gun are made up of

12th Standard Biology English Medium Free Online Test Creative 1 Mark Questions - Part Four - by Question Bank Software View & Read

  • 1)

    Gemmules are ______

  • 2)

    Attachment of blastocyst to the uterine wall is called ______

  • 3)

    This is not Major task of RCH.

  • 4)

    Depending on position of centromere and relative length of two arms human chromosomes can be classified into ________ type.

  • 5)

    ___________ used radioactive labelled molecules to prove that DNA is the genetic material.

12th Standard Botany English Medium Free Online Test One Mark Questions 2020 - by Question Bank Software View & Read

  • 1)

    First cell of male gametophyte in angiosperm is ______.

  • 2)

    Which of the following plant was introduced as a contaminant into India along with wheat?

  • 3)

    Identify the correct statement.

  • 4)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 5)

    Assertion (A): Test cross is done between F2 hybrid with F1 recessive
    Reason (R): It helps to identify the homozygosity of hybrids

12th Standard Botany English Medium Free Online Test One Mark Questions with Answer Key 2020 - by Question Bank Software View & Read

  • 1)

    Arrange the layers of anther wall from locus to periphery

  • 2)

    A typical anther is ________________

  • 3)

    Observe the diagram and select the correct option mentioning the parts A, B, C and D

  • 4)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 5)

    Select the period for Mendel’s hybridization experiments.

12th Standard Zoology English Medium Free Online Test One Mark Questions 2020 - by Question Bank Software View & Read

  • 1)

    Technique used for cultivation of sponges is based on ______

  • 2)

    Regeneration was first studied by _______

  • 3)

    The male homologue of the female clitoris is ______.

  • 4)

    _____ are endocrine cells.

  • 5)

    Sperms are released into the cavity of the seminiferous tubule by a process called _____

12th Standard Zoology English Medium Free Online Test One Mark Questions with Answer Key 2020 - by Question Bank Software View & Read

  • 1)

    During favourable conditions ______ shows multiple fission.

  • 2)

    Regeneration was first studied by _______

  • 3)

    Mammalian egg is ______.

  • 4)

    _____ may be due to cancer of the ovary.

  • 5)

    The _____ contractions lead to false labour pains.

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Five - by Question Bank Software View & Read

  • 1)

    The male homologue of the female clitoris is ______.

  • 2)

    Identify the correct statements from the following.

  • 3)

    Oral contraceptive pills contain synthetic ____ and hormones. (or) Contraceptive pills contain: 

  • 4)

    Assertion (A): IUD's are inserted in the ovary.
    Reason (R): IUD's Increases phagocytosis of the sperm.
    Codes:
    (a) Both A and R are correct
    (b) Both A and R are incorrect
    (c) A is correct R is incorrect
    (d) A is incorrect R is correct

  • 5)

    Down's syndrome is a genetic disorder which is caused by the presence of an extra chromosome number _____.

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Six - by Question Bank Software View & Read

  • 1)

    This is a method of sexual reproduction in which individuals of the same species temporarily write and exchange certain. amount of nuclear material and then get separated.

  • 2)

    Find the wrongly matched pair.

  • 3)

    The _____ prevents poly spermy.

  • 4)

    Observe the diagram and select the correct option denoting the proper sequence of parts.

  • 5)

    Fatigue, jaundice, fever, rash, stomach pain, liver Cirrhosis and liver failure - are the symptoms of

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Five - by Question Bank Software View & Read

  • 1)

    ______ is a berry shaped duster of cells.

  • 2)

    Statement (1): Menstrual cycle occurs once in every 29 days.
    Statement (2): The average age of menopause is 45-50 years.

  • 3)

    Identify the correct statement.

  • 4)

    Which of the following symbol is used in pedigree analysis to represent unspecified sex?

  • 5)

    How many structural genes are located in lac operon of E.Coli?

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Six - by Question Bank Software View & Read

  • 1)

    According to WHO, India is the ____________ largest HIV affected country.

  • 2)

    Kin selection is seen in _______

  • 3)

    The codon _________ codes for phenylalanine

  • 4)

    AUG code is for ________

  • 5)

    The Neanderthal man had the brain capacity of

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Seven - by Question Bank Software View & Read

  • 1)

    The male homologue of the female clitoris is ______.

  • 2)

    The spermatids are transformed into mature sperms by a process called ______

  • 3)

    The foetal ejection reflex is also called ____ reflex.

  • 4)

    Which of the following contributes to the seminal plasma?
    (i) Cowper's gland
    (ii) Seminal vesicles
    (iii) Prostate gland
    (iv) Bulbourethral gland

  • 5)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Seven - by Question Bank Software View & Read

  • 1)

    All the following animals are continuous breeders, except.

  • 2)

    A few statements with regard to sexual reproduction are given below:
    i. Sexual reproduction does not always require two individuals
    ii. Sexual reproduction generally involves gametic fusion
    iii. Meiosis never occurs during sexual reproduction
    iv. External fertilization is a rule during sexual reproduction
    Choose the correct statements from the options below:

  • 3)

    The Androgen Binding Protein (ABP) is produced by ________.

  • 4)

    The transfer of sperms by the male into the female genital tract is called _____

  • 5)

    The hormone _____ produced by anterior pituitary plays a major role in lactation.

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Eight - by Question Bank Software View & Read

  • 1)

    ______ is a process by which the proglottids are cut off from the tapeworm.

  • 2)

    Find the wrongly matched pair.

  • 3)

    Expulsion of baby from the mother's womb is called _____

  • 4)

    Which of the following statement is not correct?
    (i) Interstitial cells are seen surrounding the seminiferous tubule.
    (ii) Nurse cells secrete inhibin.
    (iii) Males have single prostate gland which encircles the urethra.
    (iv) Insemination, Fertilization, Implantation, Placentation, and Parturition.

  • 5)

    In embryo development of human beings, how long does it takes for a zygote to convert into morula?

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Eight - by Question Bank Software View & Read

  • 1)

    In honey bees, the mode of reproduction is

  • 2)

    The site of embryo implantation is the _____.

  • 3)

    The process which the sperm undergoes before penetrating the ovum is _____.

  • 4)

    The ______ is the smallest human cell.

  • 5)

    The unequal divisions during oogenesis results in small cells called ______

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Nine - by Question Bank Software View & Read

  • 1)

    Budding is seen in ______

  • 2)


    Identify the correct option to label the diagram
    1 - Bud forming
    2 - Osculum
    3 - Bud growing
    4 - Daughter individual
    5 - Individual parent

  • 3)

    The process which the sperm undergoes before penetrating the ovum is _____.

  • 4)

    The term after birth refers to ______

  • 5)

    Read the given statements and select the correct option.
    Statement 1: Diaphragms, cervical caps and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Nine - by Question Bank Software View & Read

  • 1)

    The milk secreted by the mammary glands soon after child birth is called ______.

  • 2)

    A contraceptive pill prevents ovulation by ______.

  • 3)

    Which of the following is true about Rh factor in the offspring of a parental combination DdxDd (both Rh positive)?

  • 4)

    Which of the following statements about DNA replication is not correct?

  • 5)

    According to Darwin, the organic evolution is due to

12th Standard Biology English Medium Free Online Test 1 Mark Questions 2020 - Part Ten - by Question Bank Software View & Read

  • 1)

    The sexual union of young individuals produced immediately after the division of the parent Cell is called _____

  • 2)

    Which of the following types of asexual reproduction is noticed in Amoeba?

  • 3)

    The process which the sperm undergoes before penetrating the ovum is _____.

  • 4)

    ______ is a hormone produced by sertoli cells.

  • 5)

    The hormone ____ brings about powerful contraction of uterine muscles during child birth.

12th Standard Biology English Medium Free Online Test One Mark Questions with Answer Key 2020 - Part Ten - by Question Bank Software View & Read

  • 1)

    All the following animals are continuous breeders, except.

  • 2)

    A few statements with regard to sexual reproduction are given below:
    i. Sexual reproduction does not always require two individuals
    ii. Sexual reproduction generally involves gametic fusion
    iii. Meiosis never occurs during sexual reproduction
    iv. External fertilization is a rule during sexual reproduction
    Choose the correct statements from the options below:

  • 3)

    Mammalian egg is ______.

  • 4)

    A contraceptive pill prevents ovulation by ______.

  • 5)

    Meselson and Stahl’s experiment proved

12th Standard Zoology - Reproduction in Organisms English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The mode of sexual reproduction in bacteria is by ______.

  • 3)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 4)

    Multiple fission is seen in _______

  • 5)

    Plasmotomy is observed in ________

12th Standard Zoology - Reproduction in Organisms English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 3)

    In, dinoflagellates the types of asexual reproduction seen is _____

  • 4)

    During favourable conditions ______ shows multiple fission.

  • 5)

    Transverse binary fission is noticed in _________________

12th Standard Zoology - Human Reproduction English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    The male sex hormone testosterone is secreted from _____.

  • 2)

    The Androgen Binding Protein (ABP) is produced by ________.

  • 3)

    Assertion(A): Ovulation is the release of ovum from the Graafian follicle.
    Reason(R): It occurs during the follicular phase of the menstrual cycle.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

  • 4)

    Spermatid \(\overset { A }{ \rightarrow }\) Spermatozoa what does 'A' stands for?

  • 5)

    ______ is a berry shaped duster of cells.

12th Standard Zoology - Human Reproduction English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    The mature sperms are stored in the ____.

  • 2)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 3)

    Colostrum is rich in ______.

  • 4)

    Which one of the following menstrual irregularities is correctly matched?

  • 5)

    Assertion(A): Head of the sperm consists of acrosome and mitochondria.
    Reason(R): Acrosome contains spiral rows of mitochondria.
    Codes:
    (a) A and R are true, R is the correct explanation of A.
    (b) A and R are true, R is not the correct explanation of A.
    (c)  A is true, R is false.
    (d) Both A and R are false.

12th Standard Zoology - Reproductive Health English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    Identify the correct statements from the following.

  • 3)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375
  • 4)

    Select the proper harmonal Composition of oral Contraceptive pills

  • 5)

    The family planning programme was initiated by India in _____

12th Standard Zoology - Reproductive Health English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    Identify the correct statements from the following.

  • 3)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375
  • 4)

    In ZIFT technique the zygote is transferred at the stage of ________

  • 5)

    In the year ______    india is expected to become the largest country in population size ______

12th Standard Zoology - Principles of Inheritance and Variation English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Haemophilia is more common in males because it is a ______.

  • 2)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

  • 3)

    If the childs blood group is ‘O’ and fathers blood group is ‘A’ and mother’s blood group is ‘B’ the genotype of the parents will be ______.

  • 4)

    A marriage between a colourblind man and a normal woman produces _______.

  • 5)

    Pataus syndrome is also referred to as ______.

12th Standard Zoology - Principles of Inheritance and Variation English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    ABO blood group in man is controlled by _____.

  • 2)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO x IAIB?

  • 3)

    What can be the blood group of offspring when both parents have AB blood group?

  • 4)

    The _______deals with the control of several inherited human diseases especially inborn errors of metabolism

  • 5)

    ZW-ZZ system of sex determination occurs in _____.

12th Standard Zoology - Molecular Genetics English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Hershey and Chase experiment with bacteriophage showed that ______.

  • 2)

    Which of the following is the correct sequence of event with reference to the central dogma?

  • 3)

    Which of the following statements is not true about DNA replication in eukaryotes?

  • 4)

    When lactose is present in the culture medium:

  • 5)

    The term gene was coined by ________

12th Standard Zoology - Molecular Genetics English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Hershey and Chase experiment with bacteriophage showed that ______.

  • 2)

    Which of the following is the correct sequence of event with reference to the central dogma?

  • 3)

    Meselson and Stahl’s experiment proved

  • 4)

    One gene one enzyme hypothesis was proposed by Beadle and Tatum based on ________

  • 5)

    The term nucleic acid was coined by ________.

12th Standard Zoology - Evolution English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    The first life on earth originated

  • 2)

    Which of the following was the contribution of Hugo de Vries?

  • 3)

    The golden age of reptiles was

  • 4)

    Modern man belongs to which period?

  • 5)

    The solar system is estimated to be _______________years old.

12th Standard Zoology - Evolution English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Who published the book “Origin of species by Natural Selection” in 1859?

  • 2)

    The age of fossils can be determined by

  • 3)

    The Neanderthal man had the brain capacity of

  • 4)

    Carbon dioxide in the primitive earth is said to have been formed from ___________

  • 5)

    _____________ was not a part of theory of chemical evolution.

12th Standard Zoology - Human Health and Diseases English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    A 30 year old woman has bleedy diarrhoea for the past 14 hours, which one of the following organisms is likely to cause this illness?

  • 2)

    The sporozoites of Plasmodium vivax are formed from ________

  • 3)

    Spread of cancerous cells to distant sites is termed as

  • 4)

    B cells that produce and release large amounts of antibody are called

  • 5)

    _________is a non infective disease.

12th Standard Zoology - Human Health and Diseases English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Exo-erythrocytic schizogony of Plasmodium takes place in _______

  • 2)

    The sporozoite of the malarial parasite is present in ______

  • 3)

    AIDS virus has

  • 4)

    Rigidity of the Jaw muscle is a symptom of__________

  • 5)

    _______is a carrier for transmitting entamoeba

12th Standard Zoology - Microbes in Human Welfare English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following microorganism is used for production of citric acid in industries?

  • 2)

    Which of the following is not involved in nitrogen fixation?

  • 3)

    The purpose of biological treatment of waste water is to _______

  • 4)

    The enzyme________is got from Aspergillus.

  • 5)

    Lactobacillus helps to produce________

12th Standard Zoology - Microbes in Human Welfare English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following pair is correctly matched for the product produced by them?

  • 2)

    CO2 is not released during

  • 3)

    WorId Biofuel day is observed on_______

  • 4)

    Aspergillus niger helps to produce________

  • 5)

    __________is free living bacteria which acts as a biofertilizer.

12th Standard Zoology - Applications of Biotechnology English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    The first clinical gene therapy was done for the treatment of

  • 2)

    ELISA is mainly used for

  • 3)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

  • 4)

    Insulin was first isolated by_______

  • 5)

    Interferons are produced using________

12th Standard Zoology - Applications of Biotechnology English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Dolly, the sheep was obtained by a technique known as

  • 2)

    Transgenic animals are those which have

  • 3)

    Vaccines that use components of a pathogenic organism rather than the whole organism are called

  • 4)

    Alpha lactalbumin is a protein with___________minoacids.

  • 5)

    Interferons were discovered by________

12th Standard Zoology - Organisms and Population English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    All populations in a given physical area are defined as

  • 2)

    Match the following and choose the correct combination from the options given below.

    Column I Column II
    A. Mutalism 1. Lion and deer
    B. Commensalism 2. Round worm and man
    C. Parasitism 3. Birds compete with squirrels for nuts
    D. Competition 4. Sea anemone on hermit crab
    E. Predation 5. Barnacles attached to Whales.
  • 3)

    The relationship between sucker fish and shark is__________

  • 4)

    Some organisms are able to maintain homeostasis by physical means _______

  • 5)

    The word 'niche' was first used by __________

12th Standard Zoology - Organisms and Population English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Organisms which can survive a wide range of temperatuer are called

  • 2)

    The figure given below is a diagrammatic representation of response of organisms to abiotic factors. What do A, B and C represent respectively.

  • 3)

    What type of human population is represented by the following age pyramid?

  • 4)

    Which of the following is a behavioural adaptation?

  • 5)

    Birds sitting on cows to eat insects is an example of ____________

12th Standard Zoology - Biodiversity and its Conservation English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following region has maximum biodiversity

  • 2)

    Which one of the following is not coming under insitu conservation

  • 3)

    Assertion(A): The Environmental conditions of the tropics are favourable for speciation and diversity of organisms.
    Reason(R): The climate seasons, temperature, humidity and photoperiod are more or less stable and congenial.

  • 4)

    There are ________ mega biodiversity countries in the world

  • 5)

    _____________ is not a threat to biodiversity.

12th Standard Zoology - Biodiversity and its Conservation English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Conservation of biodiversity within their natural habitat is

  • 2)

    Which one of the following are at high risk extinction due to habitat destruction?

  • 3)

    ___________ is a biographical gateway for much of India's flora and fauna.

  • 4)

    ________ is not a hotspot in India.

  • 5)

    At present there are ___________ tiger reserves in the country.

12th Standard Zoology - Environmental Issues English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Right to Clean Water is a fundamental right, under the Indian Constitution

  • 2)

    The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as

  • 3)

    The Hydrochlorofluorocarbons (HCFCs) are the compounds which have the following molecules:

  • 4)

    The tolerable level of sound is _____________

  • 5)

    The 2018 UN climate change conference was held in ___________

12th Standard Zoology - Environmental Issues English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    With which of the following, the Agenda 21’ of Rio Summit, 1992 is related to?

  • 2)

    The Ozone Day is observed every year on September 16 as on this day in 1987 the ___________was signed for launching efforts to arrest the depletion of the fragile ozone layer in the stratosphere that prevents the harmful ultra-violet rays of the sun from reaching the earth. Fill the correct word in blank.

  • 3)

    Oil spills can lead to ________________

  • 4)

    PCB is a major component of ______________

  • 5)

    DB is a standard abbreviation  used for the quantitative expression of

12th Standard Zoology - Immunology English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Colostrum provides

  • 2)

    All are peripheral lymphoid organs except

  • 3)

    B Cells are activated by

  • 4)

    B cells that produce and release large amounts of antibody are called

  • 5)

    Passive immunity does not exhibit this characteristic.

12th Standard Zoology - Immunology English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Paratope is an

  • 2)

    In agglutination and precipitation reactions, the antigen is a ______ and ______ respectively

  • 3)

    Raja is injured and got swelling. The swelling is due to the infection of tissue is an example of

  • 4)

    ______ is not a secondary lymphoid organ.

  • 5)

    Enhanced attachment is also known as ________

12th Standard Botany - Chromosomal Basis of Inheritance English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    The A and B genes are 10 cm apart on a chromosome. If an AB/ab heterozygote is testcrossed to ab/ab, how many of each progeny class would you expect out of 100 total progeny?

  • 2)

    Which of the following sentences are correct?
    1. The offspring exhibit only parental combinations due to incomplete linkage
    2. The linked genes exhibit some crossing over in complete linkage
    3. The separation of two linked genes are possible in incomplete linkage
    4. Crossing over is absent in complete linkage

  • 3)

    Due to incomplete linkage in maize, the ratio of parental and recombinants are ______.

  • 4)

    Changing the codon AGC to AGA represents _______.

  • 5)

    Which is not a feature of the chromosomal theory of inheritance?

12th Standard Botany - Asexual and Sexual Reproduction in Plants English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Choose the correct statement from the following

  • 2)

    Identify the incorrect pair

  • 3)

    Choose the correct statement(s) about tenuinucellate ovule.

  • 4)

    The scar left by funiculus in the seed is _______.

  • 5)

    The unit of reproductive structure used in vegetative propagation is called as __________________

12th Standard Botany - Asexual and Sexual Reproduction in Plants English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    An eminent Indian embryologist is ______.

  • 2)

    Arrange the layers of anther wall from locus to periphery

  • 3)

    Which of the following represent megagametophyte?

  • 4)

    Coelorhiza is found in ______.

  • 5)

    Which of the following aquatic plant is popularly known as the "Terror of Bengal"?

12th Standard Botany - Classical Genetics English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    In order to find out the different types of gametes produced by a pea plant having the genotype AaBb, it should be crossed to a plant with the genotype _____.

  • 2)

    Test cross involves ____.

  • 3)

    Which Mendelian idea is depicted by a cross in which the F1 generation resembles both the parents.

  • 4)

    In his classic experiments on Pea plants, Mendel did not use ______.

  • 5)

    In a test cross involving F1 dihybrid flies, more parental type offspring were produced than the recombination type offspring. This indicates ______.

12th Standard Botany - Classical Genetics English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    In order to find out the different types of gametes produced by a pea plant having the genotype AaBb, it should be crossed to a plant with the genotype _____.

  • 2)

    Test cross involves ____.

  • 3)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 4)

    In his classic experiments on Pea plants, Mendel did not use ______.

  • 5)

    In a test cross involving F1 dihybrid flies, more parental type offspring were produced than the recombination type offspring. This indicates ______.

12th Standard Botany - Chromosomal Basis of Inheritance English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    An allohexaploidy contains ______.

  • 2)

    Accurate mapping of genes can be done by three point test cross because increases _____.

  • 3)

    Genes G S L H are located on same chromosome. The recombination percentage is between L and G is 15%, S and L is 50%, H and S are 20%. The correct order of genes is _____.

  • 4)

    Assertion (A): Gamma rays are generally use to induce mutation in wheat varieties.
    Reason (R): Because they carry lower energy to non-ionize electrons from atom

  • 5)

    Name the scientist(s) who rediscovered the Mendelian work?
    (i) Hugo de Vries
    (ii) Carl Correns
    (iii) Tschermak
    (iv) T.H. Morgan

12th Standard Botany - Principles and Processes of Biotechnology English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Restriction enzymes are _____.

  • 2)

    Which one of the following palindromic base sequence in DNA can be easily cut at about the middle by some particular restriction enzymes?

  • 3)

    Which of the following one is used as a Biosensors?

  • 4)

    In which techniques Ethidium Bromide is used?

  • 5)

    Which of the following person coined the term biotechnology?

12th Standard Botany - Principles and Processes of Biotechnology English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Plasmids are ______.

  • 2)

    The process of recombinant DNA technology has the following steps
    I. amplication of the gene
    II. Insertion of recombinant DNA into the host cells
    III. Cutting of DNA at specific location using restriction enzyme .
    IV. Isolation of genetic material (DNA) Pick out the correct sequence of step for recombinant DNA technology.

  • 3)

    Assertion (A): Agrobacterium tumifaciens is popular in genetic engineering because this bacterium is associated with the root nodules of all cereals and pulse crops
    Reason(R): A gene incorporated in the bacterial chromosomal genome gets automatically transferred to the cross with which bacterium is associated.

  • 4)

    Some of the characteristics of Bt cotton are ______.

  • 5)

    Zymology deals with __________

12th Standard Botany - Plant Tissue Culture English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Totipotency refers to _____.

  • 2)

    Which of the following statement is correct

  • 3)

    Cryopreservation means it is a process to preserve plant cells, tissues or organs _____.

  • 4)

    Which of the following condition favours callus induction?

  • 5)

    A widely used fusogen in protoplast culture is ________

12th Standard Botany - Plant Tissue Culture English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Micro propagation involves _____.

  • 2)

    Select the incorrect statement from given statement.

  • 3)

    Solidifying agent used in plant tissue culture is _____.

  • 4)

    The production of secondary metabolites require the use of _________.

  • 5)

    Identify the correct sequence regarding steps involved in PTC

12th Standard Botany - Principles of Ecology English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Arrange the correct sequence of ecological hierarchy starting from lower to higher level.

  • 2)

    Which of the given plant produces cardiac glycosides?

  • 3)

    Read the given statements and select the correct option.
    Statement A : Cattle do not graze on weeds of Calotropis.
    Statement B : Calotropis have thorns and spines, as defense against herbivores.

  • 4)

    Read the following statements and fill up the blanks with correct option.
    i) Total soil water content in soil is called ______
    ii) Soil water not available to plants is called _______
    iii) Soil water available to plants is called _____.

  • 5)

    The plant of this group are adapted to live partly in water and partly above substratum and free from water ______.

12th Standard Botany - Principles of Ecology English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Ecology is the study of an individual species is called
    i) Community ecology
    ii) Autecology
    iii) Species ecology
    iv) Synecology

  • 2)

    Read the given statements and select the correct option.
    i) Hydrophytes possess aerenchyma to support themselves in water.
    ii) Seeds of Viscum are positively photoblastic as they germinate only in presence of light.
    iii) Hygroscopic water is the only soil water available to roots of plant growing in soil as it is present inside the micropores.
    iv) High temperature reduces use of water and solute absorption by roots

  • 3)

    Read the given statements and select the correct option.
    i) Loamy soil is best suited for plant growth as it contains a mixture of silt, sand and clay.
    ii) The process of humification is slow in case of organic remains containing a large amount of lignin and cellulose.
    iii) Capillary water is the only water available to plant roots as it is present inside the micropores.
    iv) Leaves of shade plant have more total chlorophyll per reaction centre, low ratio of chl a and chl b are usually thinner leaves.

  • 4)

    In soil water available for plants is ____.

  • 5)

    Ophrys an orchid resembling the female of an insect so as to able to get pollinated is due to phenomenon of ______.

12th Standard Botany - Ecosystem English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is not a abiotic component of the ecosystem?

  • 2)

    Pond is a type of ______.

  • 3)

    The following diagram represents

     

  • 4)

    Which of the following is not a sedimentary cycle

  • 5)

    Which group of organism occupies the third tropic level in an ecosystem?

12th Standard Botany - Ecosystem English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following is / are not a natural ecosystem?

  • 2)

    Solar energy used by green plants for photosynthesis is only ______.

  • 3)

    Ecosystem consists of ____.

  • 4)

    Significance of food web is / are ______.

  • 5)

    Identify the incorrect option among the following component sequence.

12th Standard Botany - Environmental Issues English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Which of the following would most likely help to slow down the greenhouse effect.

  • 2)

    Find the wrongly matched pair.

  • 3)

    One green house gas contributes 14% of total global warming and another contributes 6%. These are respectively identified as _____.

  • 4)

    Deforestation means ______.

  • 5)

    ___________ is not a method of waste water treatment.

12th Standard Botany - Environmental Issues English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    With respect to Eichhornia
    Statement A: It drains off oxygen from water and is seen growing in standing water.
    Statement B: It is an indigenous species of our country.

  • 2)

    Depletion of which gas in the atmosphere can lead to an increased incidence of skin cancer?

  • 3)

    Deforestation does not lead to _____.

  • 4)

    People’s movement for the protection of environment in Sirsi of Karnataka is ______.

  • 5)

    Which is not a greenhouse gas?

12th Standard Botany - Plant Breeding English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Assertion(A): Genetic variation provides the raw material for selection
    Reason(R): Genetic variations are differences in genotypes of the individuals.

  • 2)

    The quickest method of plant breeding is _______.

  • 3)

    Plants having similar genotypes produced by plant breeding are called _____.

  • 4)

    Dwarfing gene of wheat is ______.

  • 5)

    A wheat variety, Atlas 66 which has been used as a donor for improving cultivated wheat, which is rich in ______.

12th Standard Botany - Plant Breeding English Medium Free Online Test One Mark Questions with Answer Key 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    While studying the history of domestication of various cultivated plants _______ were recognized earlier

  • 2)

    Match Column I with Column II

    Column I Column II
    i) William S. Gaud I) Heterosis
    ii) Shull II) Mutation breeding
    iii) Cotton Mather III) Green revolution
    iv) Muller and Stadler IV) Natural hybridization
  • 3)

    Desired improved variety of economically useful crops are raised by _______.

  • 4)

    Which one of the following crop varieties correct matches with its resistance to a disease?

  • 5)

    Which of the following scientist developed world's first cotton hybrid?

12th Standard Botany - Economically Useful Plants and Entrepreneurial Botany English Medium Free Online Test One Mark Questions 2020 - 2021 - by Question Bank Software View & Read

  • 1)

    Consider the following statements and choose the right option.
    i) Cereals are members of grass family.
    ii) Most of the food grains come from monocotyledon.

  • 2)

    New world species of cotton _____.

  • 3)

    Find out the correctly matched pair.

  • 4)

    Observe the following statements and pick out the right option from the following:
    Statement I: The drug sources of Siddha include plants, animal parts, ores and minerals.
    Statement II: Minerals are used for preparing drugs with long shelf-life.

  • 5)

    Which one of the following matches is correct?

12th Standard Botany - Economically Useful Plants and Entrepreneurial Botany English Medium Online Test 1 Mark Questions with Answer Key - by Question Bank Software View & Read

  • 1)

    Assertion: Vegetables are important part of healthy eating.
    Reason: Vegetables are succulent structures of plants with pleasant aroma and flavours.

  • 2)

    Assertion: Turmeric fights various kinds of cancer
    Reason: Curcumin is an anti-oxidant present in turmeric

  • 3)

    Observe the following statements and pick out the right option from the following:
    Statement I – Perfumes are manufactured from essential oils.
    Statement II – Essential oils are formed at different parts of the plants.

  • 4)

    The active principle trans-tetra hydro canabial is present in ______.

  • 5)

    Match the common names of the given plant species with their respective binomial

    (A) Paddy (I) Vigna radiata
    (B) Lady's finger  (II) Titicum aestivum
    (C) Wheat  (III) Oryza sativa
    (D) Green gram (IV) Abelmoschus esculentus

12th Standard Biology English Medium Model 5 Mark Creative Questions (New Syllabus 2020) - by Question Bank Software View & Read

  • 1)

    Given an account on following terms.
    (a) Hologamy
    (b) Isogamy
    (c) Anisogamy
    (d) Merogamy
    (e) Paedogamy

  • 2)

    Describe the structure of human ovary.

  • 3)

    Explain any five techniques of Assisted Reproductive Technology (ART).

  • 4)

    Write a note on thalassemia.

  • 5)

    Describe Hershey and Chase experiment. What is concluded by their experiment?

12th Standard Biology English Medium Model 5 Mark Book Back Questions (New Syllabus 2020) - by Question Bank Software View & Read

  • 1)

    Differentiate between the following:
    (a) Binary fission in amoeba and multiple fission in Plasmodium
    (b) Budding in yeast and budding in Hydra
    (c) Regeneration in lizard and Planaria

  • 2)

    Identify the given image and label its parts marked as a, b, c and d

  • 3)

    The procedure of GIFT involves the transfer of female gametes into the fallopain tube, can gametes be transferred to the uterus to achieve the same result? Explain.

  • 4)

    a) Identify the figure given below
    b) Redraw the structure as a replicating fork and label the parts
    c) Write the source of energy for this replication and name the enzyme involved in this process.
    d) Mention the differences in the synthesis of protein, based on the polarity of the two template strands.

  • 5)

    Mention any three similarities found common in Neanderthal man and Homo sapiens.

12th Standard Biology English Medium Sample 5 Mark Creative Questions (New Syllabus 2020) - by Question Bank Software View & Read

  • 1)

    Explain parthenogenesis.

  • 2)

    Write a note a extra embryonic membranes.

  • 3)

    Give a detailed account on various natural methods of contraception.

  • 4)

    Write a note on allosomal chromosomal abnormalities.

  • 5)

    Describe Hershey and Chase experiment. What is concluded by their experiment?

12th Standard Biology English Medium Sample 5 Mark Book Back Questions (New Syllabus 2020) - by Question Bank Software View & Read

  • 1)

    Differentiate between the following:
    (a) Binary fission in amoeba and multiple fission in Plasmodium
    (b) Budding in yeast and budding in Hydra
    (c) Regeneration in lizard and Planaria

  • 2)

    The following is the illustration of the sequence of ovarian events (a-i) in a human female.

    a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents.
    b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events.
    c) Explain the changes that occurs in the uterus simultaneously in anticipation.
    d) Write the difference between C and H.

  • 3)

    Open Book Assessment
    ‘Healthy reproduction, legally checked birth control measures and proper family planning programmes are essential for the survival of mankind’ Justify

  • 4)

    What is extra chromosomal inheritance? 

  • 5)

    It is established that RNA is the first genetic material. Justify giving reasons.

12th Standard Biology English Medium Important 5 Mark Creative Questions (New Syllabus 2020) - by Question Bank Software View & Read

  • 1)

    Write notes on binary fission in animals.

  • 2)

    Write a note a extra embryonic membranes.

  • 3)

    What is infertility and write its causes.

  • 4)

    Write a note on allosomal chromosomal abnormalities.

  • 5)

    List the salient features of genetic code.

12th Standard Biology English Medium Important 5 Mark Book Back Questions (New Syllabus 2020) - by Question Bank Software View & Read

  • 1)

    Differentiate between the following:
    (a) Binary fission in amoeba and multiple fission in Plasmodium
    (b) Budding in yeast and budding in Hydra
    (c) Regeneration in lizard and Planaria

  • 2)

    Explain the role of oxytocin and relaxin in parturition and lactation.

  • 3)

    Amniocentesis, the foetal sex determination test, is banned in our country, Is it necessary? Comment.

  • 4)

    Discuss the genic balance mechanism of sex determination with reference to Drosophila.

  • 5)

    How is the two stage process of protein synthesis advantageous?

12th Standard Biology English Medium Model 3 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Explain multiple fission in plasmodium.

  • 2)

    What is ovoviviparous condition?

  • 3)

    Write a short note on phases of life cycle.

  • 4)

    What is polymenorrhoea?

  • 5)

    Write any three statements on Sertoli cells

12th Standard Biology English Medium Model 3 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Why are the offsprings of oviparous animal at a greater risk as compared to offsprings of viviparous organisms?

  • 2)

    What is the composition of semen?

  • 3)

    Differentiate foeticide and infanticide

  • 4)

    Brief about female heterogamety.

  • 5)

    A low level of expression of lac operon occurs at all the windows for treatment of various genetic disorders. Justify the statement

12th Standard Biology English Medium Sample 3 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    What is repeated fission?

  • 2)

    Write a short note on phases of life cycle.

  • 3)

    What is LH surge?

  • 4)

    What are primary reproductive organs? What role does they play in organisms?

  • 5)

    May 28th is celebrated as annual Menstrual Hygiene Day (MHD). State its importance

12th Standard Biology English Medium Sample 3 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Give reasons for the following:
    (a) Some organisms like honey bees are called parthenogenetic animals
    (b) A male honey bee has 16 chromosomes where as its female has 32 chromosomes

  • 2)

    Name the hormones produced from the placenta during pregnancy.

  • 3)

    Differentiate foeticide and infanticide

  • 4)

    What is male heterogamety?

  • 5)

    Why tRNA is called an adapter molecule?

12th Standard Biology English Medium Important 3 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Explain encystment in amoeba.

  • 2)

    Draw a gemmule and label any 2 parts.

  • 3)

    Give the definition for (a) Arrhenotoky (b) Thelytoky (c) Amphitoky

  • 4)

    'A' and 'B' are the male & female sex cells respectively which look alike and performs similar functions. 'A' and 'B' fuse to form a new individual 'D'. Which type of gametic fusion does this represent? Give an example

  • 5)

    What is the role of FSH & LH in spermatogenesis?

12th Standard Biology English Medium Important 3 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    The unicellular organisms which reproduce by binary fission are considered immortal. Justify

  • 2)

    What is the composition of semen?

  • 3)

    Give a schematic representation of spermatogenesis and oogenesis in humans.

  • 4)

    What are the strategies to be implemented in India to attain total reproductive health?

  • 5)

    Explain the genetic basis of ABO blood grouping man.

12th Biology English Medium Model 2 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Define regeneration mention the types.

  • 2)

    During which stagesidoes multiple fission occur is plasmodium.

  • 3)

    Differentiate between transverse binary fission and longitudinal binary fission

  • 4)

    Repeated fission is a type of multiple fission. Yes or No? Why?

  • 5)

    What is Organogenesis?

12th Biology English Medium Model 2 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Which type of reproduction is effective -Asexual or sexual and why?

  • 2)

    Draw a labeled sketch of a spermatozoan.

  • 3)

    Correct the following statements
    a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT.
    b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT.
    c) Multiload 375 is a hormone releasing IUD.

  • 4)

    What is criss-cross inheritance?

  • 5)

    Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

12th Biology English Medium Sample 2 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    What is autogamy?

  • 2)

    Name the four types of fission seen in animals

  • 3)

    What is Placentation?

  • 4)

    What is orchidectomy?

  • 5)

    Explain the term C-section.

12th Biology English Medium Sample 2 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    What is parthenogenesis? Give two examples from animals.

  • 2)

    At what stage of development are the gametes formed in new born male and female?

  • 3)

    Correct the following statements
    a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT.
    b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT.
    c) Multiload 375 is a hormone releasing IUD.

  • 4)

    Why are sex linked recessive characters more common in the male human beings?

  • 5)

    Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

12th Biology English Medium Important 2 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    What is plasmotomy?

  • 2)

    Name the types of natural parthenogenesis.

  • 3)

    Name the four types of fission seen in animals

  • 4)

    Define fertilisation.

  • 5)

    What is spermiation?

12th Biology English Medium Important 2 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Name the phenomenon where the female gamete directly develops into a new organism with an avian example.

  • 2)

    Expand the acronyms
    a. FSH
    b. LH
    c. hCG
    d. hPL

  • 3)

    Select the correct term from the bracket and complete the given branching tree

    (Barriers, Lactational amenorrhoea, CuT, Tubectomy)

  • 4)

    What is haplodiploidy?

  • 5)

    Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

12th Standard Biology English Medium  Model 1 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    ______ is seen in Aurelia.

  • 2)

    All of the following are methods of asexual reproduction except

  • 3)

    Which of the following statements, support the view that elaborate sexual reproductive process develops much later in the organic evolution?
    i. Lower groups of organisms have simpler body design
    ii. Asexual reproduction is common- in lower groups
    iii. Asexual reproduction is common in higher groups of organisms
    iv. The high incidence of sexual reproduction is in angiosperms and vertebrates.

  • 4)

    Among the extra embryonic membranes the _____ is the outer most membrane.

  • 5)

    The unequal divisions during oogenesis results in small cells called ______

12th Standard Biology English Medium Model 1 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    Assertion(A): Ovulation is the release of ovum from the Graafian follicle.
    Reason(R): It occurs during the follicular phase of the menstrual cycle.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

  • 3)

    The approach which does not give the defined action of contraceptive is

  • 4)

    Which of the following is true about Rh factor in the offspring of a parental combination DdxDd (both Rh positive)?

  • 5)

    Who is the founder of Modern Eugenics movement?

12th Standard Biology English Medium Sample 1 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Plasmotomy is observed in ________

  • 2)

    In honey bees, the mode of reproduction is

  • 3)

    Given below, are a few statements related to external fertilization. Choose the correct statements:
    i. The male and female gametes are formed and released simultaneously
    ii. Only a few gametes are released into the medium
    iii. Water is the medium in a majority of organism exhibiting external fertilization
    iv. Offspring formed as a result of external fertilization have better chance of survival than those formed inside the organism

  • 4)

    Spermatid \(\overset { A }{ \rightarrow }\) Spermatozoa what does 'A' stands for?

  • 5)

    ______ is a hormone produced by sertoli cells.

12th Standard Biology English Medium Sample 1 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The mature sperms are stored in the ____.

  • 3)

    Assertion(A): Ovulation is the release of ovum from the Graafian follicle.
    Reason(R): It occurs during the follicular phase of the menstrual cycle.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

  • 4)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 5)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

12th Standard Biology English Medium Important 1 Mark Creative Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Regeneration is not seen in ______

  • 2)

    In honey bees, the unfertilized egg produces

  • 3)

    "Nothing lives forever, but life continues". What does it mean?

  • 4)

    Assertion (A): Organisms show three phases in their life cycle.
    Reason (R): Juvenile phase is a degenerative phase.

  • 5)

    The ______ glands in human female are homologous to the bulbouretural glands.

12th Standard Biology English Medium Important 1 Mark Book Back Questions (New Syllabus) 2020 - by Question Bank Software View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    The male sex hormone testosterone is secreted from _____.

  • 3)

    The process which the sperm undergoes before penetrating the ovum is _____.

  • 4)

    Assertion(A): In human male, testes are extra abdominal and lie in scrotal sacs.
    Reason(R): Scrotum acts as thermoregulator and keeps temperature lower by 2oC for normal sperm production.
    Codes:
    (a) A and R are true, R is the correct explanation of A
    (b) A and R are true, R is not the correct explanation of A
    (c)  A is true, R is false
    (d) Both A and R are false

  • 5)

    Identify the correct statements from the following.

12th Standard Biology English Medium All Chapter Book Back and Creative One Mark Questions 2020 - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    In which mode of reproduction variations are seen _____.

  • 3)

    Autogamy is seen in ______

  • 4)


    Identify the correct option to label the diagram
    1 - Bud forming
    2 - Osculum
    3 - Bud growing
    4 - Daughter individual
    5 - Individual parent

  • 5)

    The mature sperms are stored in the ____.

12th Standard Biology English Medium All Chapter Book Back and Creative Two Mark Questions 2020 - by Question Bank Software View & Read

  • 1)

    Name an organism where cell division is itself a mode of reproduction.

  • 2)

    Name the phenomenon where the female gamete directly develops into a new organism with an avian example.

  • 3)

    Identify the parts marked as A, B, C, D, E and F for the below diagram.

  • 4)

    Define Vivipary.

  • 5)

    Mention the differences between spermiogenesis and spermatogenesis

12th Standard Biology English Medium All Chapter Book Back and Creative Three Mark Questions 2020 - by Question Bank Software View & Read

  • 1)

    The unicellular organisms which reproduce by binary fission are considered immortal. Justify

  • 2)

    Why are the offsprings of oviparous animal at a greater risk as compared to offsprings of viviparous organisms?

  • 3)

    What is Incomplete parthenogenesis? Explain with example.

  • 4)

    Meiosis is a type of cell division where the chromosomal number is reduced to half the number daughter cells. Which type of cellular division occurs in the drones to produces spermatozoa? Why?

  • 5)

    What is the composition of semen?

12th Standard Biology English Medium All Chapter Book Back and Creative Five Mark Questions 2020 - by Question Bank Software View & Read

  • 1)

    Differentiate between the following:
    (a) Binary fission in amoeba and multiple fission in Plasmodium
    (b) Budding in yeast and budding in Hydra
    (c) Regeneration in lizard and Planaria

  • 2)

    How is juvenile phase different from reproductive phase?

  • 3)

    Write notes on binary fission in animals.

  • 4)

    Describe the regeneration process noticed in living organism.

  • 5)

    Explain the role of oxytocin and relaxin in parturition and lactation.

12th Zoology - Immunology - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role.

  • 2)

    How does saliva act inbody defence?

  • 3)

    How does immune system work?

  • 4)

    Name and explain the type of barriers which involve macrophages.

  • 5)

    What are interferons? Mention their role.

12th Botany - Economically Useful Plants and Entrepreneurial Botany - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Give the binomials of paddy and wheat.

  • 2)

    What is maida? Mention its culinary purpose.

  • 3)

    Name any four millet varieties.

  • 4)

    Ragi rich food helps to overcome bone related ailments - justify.

  • 5)

    Eating millets is good for diabetic patients. How?

12th Botany - Plant Breeding - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    What is meant by domestication of plants?

  • 2)

    Mention any two free-living nitrogen-fixing bacteria.

  • 3)

    What are bio-pesticides? Why they are considered better than synthetic pesticides?

  • 4)

    Name any four plants used in Green leaf manuring

  • 5)

    Define acclimatization.

12th Botany - Environmental Issues - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    What is ozone hole?

  • 2)

    Give four examples of plants cultivated in commercial agroforestry.

  • 3)

    Expand CCS. (or) What is CCS?

  • 4)

    Define Greenhouse gases and list out its examples

  • 5)

    Name any four greenhouse gases.

12th Botany - Ecosystem - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Productivity of profundal zone will be low. Why?

  • 2)

    Discuss the gross primary productivity is more efficient than net primary productivity.

  • 3)

    Pyramid of energy is always upright. Give reasons

  • 4)

    What will happen if all producers are removed from ecosystem?

  • 5)

    According to A.G. Tansley, what is an ecosystem?

12th Botany - Principles of Ecology - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Define ecology.

  • 2)

    What is ecological hierarchy? Name the levels of ecological hierarchy. 

  • 3)

    What are ecological equivalents? Give one example

  • 4)

    Distinguish habitat and niche

  • 5)

    Why are some organisms called as eurythermals and some others as stenohaline ?

12th Botany - Plant Tissue Culture - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    What is the name of the process given below? Write its 4 types.

  • 2)

    How will you avoid the growing of microbes in nutrient medium during culture process? What are the techniques used to remove the microbes?

  • 3)

    Write the various steps involved in cell suspension culture.

  • 4)

    What do you mean Embryoids? Write its application.

  • 5)

    Define tissue culture.

12th Botany - Principles and Processes of Biotechnology - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    How do you use the biotechnology in modern practice?

  • 2)

    What are the materials used to grow microorganism like Spirulina?

  • 3)

    You are working in a biotechnology lab with a becterium namely E.coli. How will you cut the nucleotide sequence? explain it.

  • 4)

    What are the enzymes you can used to cut terminal end and internal phospho di ester bond of nucleotide sequence?

  • 5)

    Name the chemicals used in gene transfer.

12th Botany - Chromosomal Basis of Inheritance - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    When two different genes came from same parent they tend to remain together.
    i) What is the name of this phenomenon?
    ii) Draw the cross with suitable example.
    iii) Write the observed phenotypic ratio.

  • 2)

    If you cross dominant genotype PV/PV male Drosophila with double recessive female and obtain F1 hybrid. Now you cross F1 male with double recessive female.
    i) What type of linkage is seen?
    ii) Draw the cross with correct genotype.
    iii) What is the possible genotype in F2 generation?

  • 3)
    s.no gamete types Number of progenies
    1 ABC 349
    2 Abc 114
    3 abC 124
    4 AbC 5
    5 aBc 4
    6 aBC 116
    7 ABc 128
    8 abc 360

    i) What is the name of this test cross?
    ii) How will you construct gene mapping from the above given data?
    iii) Find out the correct order of genes.

  • 4)

    What is the difference between missense and nonsense mutation?

  • 5)

    Define linkage. Mention its types.

12th Botany - Classical Genetics - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Name the seven contrasting traits of Mendel.

  • 2)

    What is meant by true breeding or pure breeding lines / strain?

  • 3)

    Give the names of the scientists who rediscovered Mendelism

  • 4)

    What is back cross?

  • 5)

    Define Genetics.

12th Botany - Asexual and Sexual Reproduction in Plants - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    What is reproduction?

  • 2)

    Mention the contribution of Hofmeister towards Embryology.

  • 3)

    List out two sub-aerial stem modifications with example.

  • 4)

    What is layering?

  • 5)

    What are clones?

12th Zoology - Environmental Issues - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Expand
    (i) CFC
    (ii) AQI
    (iii) PAN

  • 2)

    What is SMOG and how it is harmful for us?

  • 3)

    List all the wastes that you generate, at home, school or during your trips to other places. Could you very easily reduce the generation of these wastes? Which would be difficult or rather impossible to reduce?

  • 4)

    Discuss the causes and effects of global warming. What measures need to be taken to control global warming?

  • 5)

    What would Earth be like without the greenhouse effect?

12th Zoology - Biodiversity and its Conservation - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Define endemism

  • 2)

    How many hotspots are there in India? Name them

  • 3)

    What are the three levels of biodiversity?

  • 4)

    Name the active chemical found in the medicinal plant Rauwolfia vomitoria. What type of diversity it belongs to?

  • 5)

    “Amazon forest is considered to be the lungs of the planet”- Justify this statement.

12th Zoology - Organisms and Population - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    What is a Habitat?

  • 2)

    Define ecological niche.

  • 3)

    What is Acclimatisation?

  • 4)

    What is Pedogenesis?

  • 5)

    What is Zero Stress?

12th Zoology - Applications of Biotechnology - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Mention the number of primers required in each cycle of PCR. Write the role of primers and DNA polymerase in PCR. Name the source organism of the DNA polymerase used in PCR.

  • 2)

    How is the amplification of a gene sample of interest carried out using PCR?

  • 3)

    What is genetically engineered Insulin?

  • 4)

    Explain how “Rosie” is different from a normal cow

  • 5)

    How was Insulin obtained before the advent of rDNA technology? What were the problems encountered?

12th Zoology - Microbes in Human Welfare - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    How is milk converted into curd? Explain the process of curd formation

  • 2)

    Give any two bioactive molecules produced by microbes and state their uses.

  • 3)

    What is biological oxygen demand?

  • 4)

    What is biocontrol?

  • 5)

    What are biopesticides?

12th Zoology - Human Health and Diseases - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role. Liver, thymus, stomach, thyroid, tonsils.

  • 2)

    Name and explain the type of barriers which involve macrophages.

  • 3)

    What are interferons? Mention their role.

  • 4)

    List out chemical alarm signals produced during inflammation.

  • 5)

    Explain the process of replication of retrovirus after it gains entry into the human body.

12th Zoology - Evolution - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    List out the major gases seems to be found in the primitive earth.

  • 2)

    Explain the three major categories in which fossilization occur?

  • 3)

    Differentiate between divergent evolution and convergent evolution with one example for each.

  • 4)

    How does Hardy-Weinberg’s expression (p2 + 2pq + q2 = 1) explain that genetic equilibrium is maintained in a population? List any four factors that can disturb the genetic equilibrium.

  • 5)

    Explain how mutations, natural selection and genetic drift affect Hardy Weinberg equilibrium.

12th Zoology - Molecular Genetics - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Give reasons: ‘Genetic code is universal’.

  • 2)

    Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

  • 3)

    Differentiate - Leading stand and lagging strand

  • 4)

    Differentiate - Template strand and coding strand.

  • 5)

    Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

12th Zoology - Principles of Inheritance and Variation - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    What is haplodiploidy?

  • 2)

    Distinguish between heterogametic and homogametic sex determination systems

  • 3)

    What is Lyonisation?

  • 4)

    What is criss-cross inheritance?

  • 5)

    Why are sex linked recessive characters more common in the male human beings?

12th Zoology - Reproductive Health - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    What is amniocentesis? Why a statutory ban is imposed on this technique?

  • 2)

    Select the correct term from the bracket and complete the given branching tree

    (Barriers, Lactational amenorrhoea, CuT, Tubectomy)

  • 3)

    Correct the following statements
    a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT.
    b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT.
    c) Multiload 375 is a hormone releasing IUD.

  • 4)

    Which method do you suggest the couple to have a baby, if the male partner fails to inseminate the female or due to very low sperm count in the ejaculate?

  • 5)

    Which type of women are benefited by Invitro fertilization?

12th Zoology - Human Reproduction - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Mention the differences between spermiogenesis and spermatogenesis

  • 2)

    At what stage of development are the gametes formed in new born male and female?

  • 3)

    Expand the acronyms
    a. FSH
    b. LH
    c. hCG
    d. hPL

  • 4)

    How is polyspermy avoided in humans?

  • 5)

    What is colostrum? Write its significance.

12th Zoology - Reproduction in Organisms - Two Marks Study Materials - by 8682895000 View & Read

  • 1)

    Name an organism where cell division is itself a mode of reproduction.

  • 2)

    Name the phenomenon where the female gamete directly develops into a new organism with an avian example.

  • 3)

    What is parthenogenesis? Give two examples from animals.

  • 4)

    Which type of reproduction is effective -Asexual or sexual and why?

  • 5)

    Name the types of fission.

12th Biology - Full Portion Five Marks Question Paper - by 8682895000 View & Read

  • 1)

    The following is the illustration of the sequence of ovarian events (a-i) in a human female.

    a) Identify the figure that illustrates ovulation and mention the stage of oogenesis it represents.
    b) Name the ovarian hormone and the pituitary hormone that have caused the above-mentioned events.
    c) Explain the changes that occurs in the uterus simultaneously in anticipation.
    d) Write the difference between C and H.

  • 2)

    Explain the process of oogenesis.

  • 3)

    Amniocentesis, the foetal sex determination test, is banned in our country, Is it necessary? Comment.

  • 4)

    Explain the inheritance of sex linked characters in human being.

  • 5)

    How is the two stage process of protein synthesis advantageous?

12th Biology - Full Portion Three Marks Question Paper - by 8682895000 View & Read

  • 1)

    Why is the offspring formed by asexual reproduction referred as a clone?

  • 2)

    What is strobilation?

  • 3)

    How exogenous buds are developed by Hydra?

  • 4)

    Complete the flow chart by mentioning the ploidy of cells in boxes.

  • 5)

    What is Ferguson reflex?

12th Biology - Full Portion Two Marks Question Paper - by 8682895000 View & Read

  • 1)

    Name the phenomenon where the female gamete directly develops into a new organism with an avian example.

  • 2)

    Define regeneration mention the types.

  • 3)

    Identify the parts marked as A, B, C, D, E and F for the below diagram.

  • 4)

    What is amniocentesis? Why a statutory ban is imposed on this technique?

  • 5)

    What are holandric genes?

12th Biology - Public Model Question Paper 2019 - 2020 - by Question Bank Software View & Read

  • 1)

    Fusion of morphologically and physiologically similar gametes is called ______

  • 2)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 3)

    Watson and Crick proposed their double helical DNA model based on the X-ray diffraction analysis of _________

  • 4)

    Darwin’s finches are an excellent example of

  • 5)

    Select the correct statement from the following

12th Biology - Zoology - Immunology Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Paratope is an

  • 2)

    All are peripheral lymphoid organs except

  • 3)

    B Cells are activated by

  • 4)

    ______ is not a feature of acquired immunity.

  • 5)

    Lymph nodes are seen in the ______

12th Biology - Botany - Economically Useful Plants and Entrepreneurial Botany Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Tectona grandis is coming under family _____.

  • 2)

    Observe the following statements and pick out the right option from the following:
    Statement I – Perfumes are manufactured from essential oils.
    Statement II – Essential oils are formed at different parts of the plants.

  • 3)

    Observe the following statements and pick out the right option from the following:
    Statement I: The drug sources of Siddha include plants, animal parts, ores and minerals.
    Statement II: Minerals are used for preparing drugs with long shelf-life.

  • 4)

    Match the common names of the given plant species with their respective binomial

    (A) Paddy (I) Vigna radiata
    (B) Lady's finger  (II) Titicum aestivum
    (C) Wheat  (III) Oryza sativa
    (D) Green gram (IV) Abelmoschus esculentus
  • 5)

    Identify the tamil name for flaked rice

12th Biology - Botany - Plant Breeding Practice Question Paper - by Question Bank Software View & Read

  • 1)

    The quickest method of plant breeding is _______.

  • 2)

    Jaya and Ratna are the semi dwarf varieties of ______.

  • 3)

    Match list I with list II

    List I List II
    Biofertilizer Organisms
    i) Free living N2 a) Aspergillus
    ii) Symbiotic N2 b) Amanita
    iii) P Solubilizing c) Anabaena azollae
    iv) P Mobilizing d) Azotobactor
  • 4)

    Which of the following scientist developed world's first cotton hybrid?

  • 5)

    Assertion (A): SLF promotes vigorous growth and provide resistance against diseases.
    Reason (R): SLF is made from kelp containing more than 70 minerals.

12th Biology - Botany - Environmental Issues Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Find the wrongly matched pair.

  • 2)

    Deforestation does not lead to _____.

  • 3)

    Identify the incorrect statement with regard to Global warming

  • 4)

    Invasive species _______________

  • 5)

    The ozone layer of ___________ is called bad ozone.

12th Biology - Botany - Ecosystem Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Which of the following is / are not a natural ecosystem?

  • 2)

    Solar energy used by green plants for photosynthesis is only ______.

  • 3)

    The following diagram represents

     

  • 4)

    Which of the following are not regulating services of ecosystem services
    i) Genetic resources
    ii) Recreation and aesthetic values
    iii) Invasion resistance
    iv) Climatic regulation

  • 5)

    Pick out the edaphic factor among the following.

12th Biology - Botany - Principles of Ecology Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Ecology is the study of an individual species is called
    i) Community ecology
    ii) Autecology
    iii) Species ecology
    iv) Synecology

  • 2)

    In soil water available for plants is ____.

  • 3)

    Pedogenesis refers to _____.

  • 4)

    Identify the indicators of fire.

  • 5)

    Earth day is observed on

12th Biology - Botany - Plant Tissue Culture Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Micro propagation involves _____.

  • 2)

    Solidifying agent used in plant tissue culture is _____.

  • 3)

    Protoplast are the cells devoid of ___________

  • 4)

    Assertion (A) : Sterilization helps to overcome microbes.
    Reason (R) : Explants are autoclaved.

  • 5)

    The term used to define the ability of a cell to generate entire individual is

12th Biology - Botany - Principles and Processes of Biotechnology Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Plasmids are ______.

  • 2)

    An analysis of chromosomal DNA using the southern hybridisation technique does not use _____.

  • 3)

    Zymology deals with __________

  • 4)

    The bacteria responsible for causing Crown Gall:

  • 5)

    Statement 1: DNA is a hydrophobic molecule.
    Statement 2: T-DNA is a part ofE-coli plasmid.

12th Biology - Botany - Chromosomal Basis of Inheritance Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Which of the following sentences are correct?
    1. The offspring exhibit only parental combinations due to incomplete linkage
    2. The linked genes exhibit some crossing over in complete linkage
    3. The separation of two linked genes are possible in incomplete linkage
    4. Crossing over is absent in complete linkage

  • 2)

    How many map units separate two alleles A and B if the recombination frequency is 0.09?

  • 3)

    Which is not a feature of the chromosomal theory of inheritance?

  • 4)

    Mechanism of crossing over involves the following stages. Select the correct sequence.

  • 5)

    Transition type of gene mutation is caused when__________

12th Biology - Botany - Classical Genetics Practice Question Paper - by Question Bank Software View & Read

  • 1)

    In Mendel’s experiments with garden pea, round seed shape (RR) was dominant over wrinkled seeds (rr), yellow cotyledon (YY) was dominant over green cotyledon (yy). What are the expected phenotypes in the F2 generation of the cross RRYY x rryy?

  • 2)

    Gene which suppresses other genes activity but does not lie on the same locus is called as _____.

  • 3)

    Which is not a correct statement?
    (A) Variations are the raw materials for evolution
    (B) Variations provide genetic material for natural selection
    (C) It helps the individual to adapt to the changing environment
    (D) Variations allow breeders to improve the crop field

  • 4)

    How many characters studied by Mendel in pisum sativum

  • 5)

    Identify the incorrect statement

12th Biology - Botany - Asexual and Sexual Reproduction in Plants Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Size of pollen grain in Myosotis ______.

  • 2)

    Arrange the layers of anther wall from locus to periphery

  • 3)

    Assertion(A) : Sporopollenin preserves pollen in fossil deposits
    Reason (R): Sporopollenin is resistant to physical and biological decomposition

  • 4)

    Which of the following aquatic plant is popularly known as the "Terror of Bengal"?

  • 5)

    Which is not a part of mature seed?

12th Biology - Zoology - Environmental Issues Practice Question Paper - by Question Bank Software View & Read

  • 1)

    As per 2017 statistics, the highest per capita emitter of Carbon dioxide in the world is

  • 2)

    PCB is a major component of ______________

  • 3)

    A lake which is rich in organic waste may result in

  • 4)

    Identify the incorrect statement.
    (i) EcoSan toilets is a sustainable way for handling human excreta by using dry composting toilets
    (ii) It reduces waste water generation
    (Ui) It is based on recovery and recycling of nutrients from excreta
    (iv) EcoSan toilets are used in several parts of India and Srilanka.

  • 5)

    Assertion (A): Evolution of Greenhouse gases leads to Global warming
    Reason (R): The energy released by the greenhouse gases move away from the atmospheric

12th Biology - Zoology - Biodiversity and its Conservation Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Who introduced the term biodiversity?

  • 2)

    The grizzled squirrel and lion tailed Macaque are endemic to _____________

  • 3)

    ________ is not a hotspot in India.

  • 4)

    Mundanthurai wild life sanctuary is located in ___________ district.

12th Biology - Zoology - Organisms and Population Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Which of the following is an r-species

  • 2)

    "Birds and mammals attain greater body size in colder regions than warmer regions." - Choose the correct option.

  • 3)

    A biologist studies the population of eats in a barn. He found that the average natality was 250, average mortality is 240, immigration is 20 and emigration to be 30. The  in population is

  • 4)

    Pick out the correct statement regarding K-selected species

  • 5)

    Death rate is also known as ___________

12th Biology - Zoology - Applications of Biotechnology Practice Question Paper - by Question Bank Software View & Read

  • 1)

    The genetic defect adenosine deaminase deficiency may be cured permanently by

  • 2)

    The first synthetic vaccine produced was_________

  • 3)

    This is not the advantage of new generation vaccine

  • 4)

    PCR was developed by___________

  • 5)

    Statement 1: Rosie was the first transgenic goat.
    Statement 2: Meat is enriched with human protein

12th Biology - Zoology - Microbes in Human Welfare Practice Question Paper - by Question Bank Software View & Read

  • 1)

    The gases produced in anaerobic sludge digesters are

  • 2)

    ________is not used as a biofertilizer

  • 3)

    Which of the following are likely to be present in deep-sea water?

  • 4)

    Tetracycline is a ________________
    (i) bactericidal antibiotic
    (ii) bacteriastatic antibiotic
    (iii) narrow spectrum antibiotic
    (iv) Broad spectrum antibiotic

  • 5)

    Select the correct option denoting the proper sequence of sewage tratment.

12th Biology - Zoology - Human Health and Diseases Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Choose the correctly match pair.

  • 2)

    The site of infection for yersinia pestis is___________

  • 3)

    ___________is not a symptom of Kala-azar

  • 4)

    ________is a plant with hallucinogenic properties

  • 5)

    Choose the symptom not seen in amoebiasis

12th Biology - Zoology - Evolution Practice Question Paper - by Question Bank Software View & Read

  • 1)

    The age of fossils can be determined by

  • 2)

    Origin of fishes occurred in ___________ period

  • 3)

    Founder's effect is related to

  • 4)

    Which one of the following brings about evidence for convergent evolution?

  • 5)

    Genetic drift leads to

12th Biology - Zoology - Molecular Genetics Practice Question Paper - by Question Bank Software View & Read

  • 1)

    What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

  • 2)

    The first codon to be deciphered was ______ which codes for ________.

  • 3)

    The classical concept of a gene was given by _______.

  • 4)

    The term ___________ refers to DNA of Prokaryotes.

  • 5)

    In genetic code there are __________ possible triplets.

12th Biology - Zoology - Principles of Inheritance and Variation Practice Question Paper - by Question Bank Software View & Read

  • 1)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

  • 2)

    Father of a child is colourblind and mother is carrier for colourblindness, the probability of the child being colourblind is _____.

  • 3)

    Improvement of human race by encouraging the healthy persons to marry early and produce large number of children is called

  • 4)

    Which of the following is incorrect regarding ZW-ZZ type of sex determination?

  • 5)

    The secretors have the I allele in _______.

12th Biology - Zoology - Reproductive Health Practice Question Paper - by Question Bank Software View & Read

  • 1)

    The approach which does not give the defined action of contraceptive is

  • 2)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 3)

    Sperm remains active for _____ hours in the female reproductive tract

  • 4)

    ____ vaccination of girls between 9-13 years can prevent cervical cancer.

  • 5)

    ______ is needed for normal functioning of reproductive structures

12th Biology - Zoology - Human Reproduction Practice Question Paper - by Question Bank Software View & Read

  • 1)

    The foetal membrane that forms the basis of the umbilical cord is _____.

  • 2)

    The Androgen Binding Protein (ABP) is produced by ________.

  • 3)

    Spermatid \(\overset { A }{ \rightarrow }\) Spermatozoa what does 'A' stands for?

  • 4)

    ______ is popularly known as sperm lysin.

  • 5)

    The dividing embryo takes ______ days to move to the uterus from the fallopian tube.

12th Biology - Zoology - Reproduction in Organisms Practice Question Paper - by Question Bank Software View & Read

  • 1)

    The mode of sexual reproduction in bacteria is by ______.

  • 2)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 3)

    During favourable conditions ______ shows multiple fission.

  • 4)

    If the entire organism behaves as a gamete the Phenomenon is called _____

  • 5)

    Human beings exhibit ______

12th Biology - Molecular Genetics Model Question Paper - by Question Bank Software View & Read

  • 1)

    What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

  • 2)

    Which of the following is the correct sequence of event with reference to the central dogma?

  • 3)

    Meselson and Stahl’s experiment proved

  • 4)

    One gene one enzyme hypothesis was proposed by Beadle and Tatum based on ________

  • 5)

    The experiment conducted by Griffith was based on_________.

12th Biology - Principles of Inheritance and Variation Model Question Paper - by Question Bank Software View & Read

  • 1)

    ABO blood group in man is controlled by _____.

  • 2)

    Which of the following is true about Rh factor in the offspring of a parental combination DdxDd (both Rh positive)?

  • 3)

    XO type of sex determination and XY type of sex determination are examples of ______.

  • 4)

    _________ proposed the existence of 8 alleles at a single Rh locus.

  • 5)

    The lygaeus type (XX - XY) type of sex determination is seen in ______

12th Biology - Reproductive Health Model Question Paper - by Question Bank Software View & Read

  • 1)

    The approach which does not give the defined action of contraceptive is

  • 2)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 3)

    In ZIFT technique the zygote is transferred at the stage of ________

  • 4)

    In the year ______    india is expected to become the largest country in population size ______

  • 5)

    Formation of chronic ulcer is a symptom of ______

12th Biology - Human Reproduction Important Questions - by Question Bank Software View & Read

  • 1)

    The most important hormone in intiating and maintaining lactation after birth is ______.

  • 2)

    Mammalian egg is ______.

  • 3)

    The Androgen Binding Protein (ABP) is produced by ________.

  • 4)

    _____ are endocrine cells.

  • 5)

    ____ is not linked to male reproductive system.

12th Biology - Reproduction in Organisms Important Questions - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 3)

    Plasmotomy is observed in ________

  • 4)

    Giant Amoeba refers to ______

  • 5)

    Budding is seen in ______

12th Biology - Half Yearly Model Question Paper 2019 - by Question Bank Software View & Read

  • 1)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A) : In bee society, all the members are diploid except drones.
    Reason (R) : Drones are produced by parthenogenesis
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 2)

    Assertion (A): The acrosome of the Sperm cell contains Sperm lysin.
    Reason (R): Sperm lysin destroys the deformed Sperm cells.

  • 3)

    The approach which does not give the defined action of contraceptive is

  • 4)

    DOPA stands for __________

  • 5)

    A mRNA molecule is produced by _____.

12th Standard Biology - Zoology - Immunology Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Paratope is an

  • 2)

    Allergy involves

  • 3)

    Spread of cancerous cells to distant sites is termed as

  • 4)

    Which is not a macrophage?

  • 5)

    B Cells are activated by

12th Botany - Economically Useful Plants and Entrepreneurial Botany Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Groundnut is native of ____.

  • 2)

    Tectona grandis is coming under family _____.

  • 3)

    New world species of cotton _____.

  • 4)

    The active principle trans-tetra hydro canabial is present in ______.

  • 5)

    The only cereal that has originated and domesticated from the New world.

12th Botany - Plant Breeding Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    The quickest method of plant breeding is _______.

  • 2)

    Plants having similar genotypes produced by plant breeding are called _____.

  • 3)

    Importing better varieties and plants from outside and acclimatising them to local environment is called _____.

  • 4)

    Crosses between the plants of the same variety are called ____.

  • 5)

    Jaya and Ratna are the semi dwarf varieties of ______.

12th Biology - Botany - Environmental Issues Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Depletion of which gas in the atmosphere can lead to an increased incidence of skin cancer?

  • 2)

    One green house gas contributes 14% of total global warming and another contributes 6%. These are respectively identified as _____.

  • 3)

    The unit for measuring ozone thickness _____.

  • 4)

    The plants which are grown in silivpasture system are ______.

  • 5)

    Which is not a greenhouse gas?

12th Biology - Botany - Ecosystem Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Which of the following is not a abiotic component of the ecosystem?

  • 2)

    Pond is a type of ______.

  • 3)

    Solar energy used by green plants for photosynthesis is only ______.

  • 4)

    Ecosystem consists of ____.

  • 5)

    Which of the following is / are not the mechanism of decomposition

12th Biology - Botany - Principles of Ecology Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Arrange the correct sequence of ecological hierarchy starting from lower to higher level.

  • 2)

    Which of the given plant produces cardiac glycosides?

  • 3)

    In soil water available for plants is ____.

  • 4)

    The plant of this group are adapted to live partly in water and partly above substratum and free from water ______.

  • 5)

    A free living nitrogen fixing cyanobacterium which can also form symbiotic association with the water fern Azolla ______.

12th Biology - Botany - Plant Tissue Culture Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Micro propagation involves _____.

  • 2)

    The time duration for sterilization process by using autoclave is ______ minutes and the temperature is ______.

  • 3)

    Virus free plants are developed from _____.

  • 4)

    The prevention of large scale loss of biological interity ____.

  • 5)

    Identify the group of scientists who developed the intergenic hybrid - the pomato.

12th Biology - Botany - Principles and Processes of Biotechnology Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Restriction enzymes are _____.

  • 2)

    Plasmids are ______.

  • 3)

    Which of the following one is used as a Biosensors?

  • 4)

    An analysis of chromosomal DNA using the southern hybridisation technique does not use _____.

  • 5)

    Some of the characteristics of Bt cotton are ______.

12th Biology - Botany - Chromosomal Basis of Inheritance Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    An allohexaploidy contains ______.

  • 2)

    Genes G S L H are located on same chromosome. The recombination percentage is between L and G is 15%, S and L is 50%, H and S are 20%. The correct order of genes is _____.

  • 3)

    Changing the codon AGC to AGA represents _______.

  • 4)

    How many map units separate two alleles A and B if the recombination frequency is 0.09?

  • 5)

    The following sequence represents the location of genes in a chromosome. A - B - C - M - R - S - y -Z. Which of the gene pairs will have least chance of getting inherited together?

12th Standard Biology - Botany - Classical Genetics Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    How many different kinds of gametes will be produced by a plant having the genotype AABbCC?

  • 2)

    In pea plants, yellow seeds are dominant to green. If a heterozygous yellow seed plant is crossed with a green seeded plant, what ratio of yellow and green seeded plants would you expect in F1 generation?

  • 3)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 4)

    Fruit colour in squash is an example of ______.

  • 5)

    The genes controlling the seven pea characters studied by Mendel are known to be located on how many different chromosomes?

12th Standard Biology - Botany - Asexual and Sexual Reproduction in Plants Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    An eminent Indian embryologist is ______.

  • 2)

    Identify the correctly matched pair.

  • 3)

    Identify the incorrect pair

  • 4)

    Which of the following represent megagametophyte?

  • 5)

    In Haplopappus gracilis, number of chromosomes in cells of nucellus is 4. What will be the chromosome number in Primary endosperm cell?

12th Biology - Botany - Environmental Issues Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Which of the following would most likely help to slow down the greenhouse effect.

  • 2)

    Deforestation means ______.

  • 3)

    People’s movement for the protection of environment in Sirsi of Karnataka is ______.

  • 4)

    The plants which are grown in silivpasture system are ______.

  • 5)

    Which is not a greenhouse gas?

12th Biology - Botany - Ecosystem Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Which of the following is not a abiotic component of the ecosystem?

  • 2)

    Solar energy used by green plants for photosynthesis is only ______.

  • 3)

    Ecosystem consists of ____.

  • 4)

    Significance of food web is / are ______.

  • 5)

    Which of the following is / are not the mechanism of decomposition

12th Standard Biology - Botany - Principles of Ecology Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    A specific place in an ecosystem, where an organism lives and performs its functions is _____.

  • 2)

    Which of the given plant produces cardiac glycosides?

  • 3)

    In soil water available for plants is ____.

  • 4)

    Ophrys an orchid resembling the female of an insect so as to able to get pollinated is due to phenomenon of ______.

  • 5)

    Pedogenesis refers to _____.

12th Biology - Botany - Plant Tissue Culture Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Totipotency refers to _____.

  • 2)

    The time duration for sterilization process by using autoclave is ______ minutes and the temperature is ______.

  • 3)

    Virus free plants are developed from _____.

  • 4)

    The prevention of large scale loss of biological interity ____.

  • 5)

    Solidifying agent used in plant tissue culture is _____.

12th Standard Biology - Botany - Principles and Processes of Biotechnology Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Which of the following one is used as a Biosensors?

  • 2)

    Which one of the following is not correct statement

  • 3)

    Some of the characteristics of Bt cotton are ______.

  • 4)

    The bacteria responsible for causing Crown Gall:

  • 5)

    Self-ligation is prevented by____________

12th Biology - Botany - Chromosomal Basis of Inheritance Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Due to incomplete linkage in maize, the ratio of parental and recombinants are ______.

  • 2)

    Genes G S L H are located on same chromosome. The recombination percentage is between L and G is 15%, S and L is 50%, H and S are 20%. The correct order of genes is _____.

  • 3)

    Changing the codon AGC to AGA represents _______.

  • 4)

    Which is not a feature of the chromosomal theory of inheritance?

  • 5)

    Incomplete linkage was reported by Hutchinson in ___________

12th Biology - Botany - Classical Genetics Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in _____.

  • 2)

    In pea plants, yellow seeds are dominant to green. If a heterozygous yellow seed plant is crossed with a green seeded plant, what ratio of yellow and green seeded plants would you expect in F1 generation?

  • 3)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 4)

    Which Mendelian idea is depicted by a cross in which the F1 generation resembles both the parents.

  • 5)

    “Gametes are never hybrid”. This is a statement of ______.

12th Biology - Botany - Asexual and Sexual Reproduction in Plants Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    An eminent Indian embryologist is ______.

  • 2)

    Identify the correctly matched pair.

  • 3)

    Pollen tube was discovered by ______.

  • 4)

    Identify the incorrect pair

  • 5)

    Which of the following represent megagametophyte?

12th Standard Biology - Term II Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    The site of embryo implantation is the _____.

  • 3)

    Down's syndrome is a genetic disorder which is caused by the presence of an extra chromosome number _____.

  • 4)

    A mRNA molecule is produced by _____.

  • 5)

    An operon is a: ______.

12th Standard Biology - Zoology - Biodiversity and its Conservation Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Which of the following region has maximum biodiversity

  • 2)

    Which one of the following is not coming under insitu conservation

  • 3)

    Who introduced the term biodiversity?

  • 4)

    Which one of the following are at high risk extinction due to habitat destruction?

  • 5)

    The grizzled squirrel and lion tailed Macaque are endemic to _____________

12th Standard Biology - Zoology - Environmental Issues Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Right to Clean Water is a fundamental right, under the Indian Constitution

  • 2)

    The ‘thickness’ of Stratospheric Ozone layer is measured in/on:

  • 3)

    As per 2017 statistics, the highest per capita emitter of Carbon dioxide in the world is

  • 4)

    The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as

  • 5)

    Which among the following always decreases in a Food chain across tropic levels?

12th Biology - Zoology - Organisms and Population Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    All populations in a given physical area are defined as

  • 2)

    Competition between species leads to

  • 3)

    Which of the following is an r-species

  • 4)

    The relationship between sucker fish and shark is__________

  • 5)

    Animals that can move from fresh water to sea called as______

12th Standard Biology - Zoology - Applications of Biotechnology Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    The first clinical gene therapy was done for the treatment of

  • 2)

    PCR proceeds in three distinct steps governed by temperature, they are in order of

  • 3)

    ELISA is mainly used for

  • 4)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

  • 5)

    Vaccines that use components of a pathogenic organism rather than the whole organism are called

12th Standard Biology - Zoology - Microbes in Human Welfare Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Which of the following pair is correctly matched for the product produced by them?

  • 2)

    Which of the following is not involved in nitrogen fixation?

  • 3)

    CO2 is not released during

  • 4)

    WorId Biofuel day is observed on_______

  • 5)

    Aspergillus niger helps to produce________

12th Standard Biology - Zoology - Human Health and Diseases Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Exo-erythrocytic schizogony of Plasmodium takes place in _______

  • 2)

    Choose the correctly match pair.

  • 3)

    Cirrhosis of liver is caused by chronic intake of ______

  • 4)

    Allergy involves

  • 5)

    AIDS virus has

12th Zoology - Evolution Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Taking the example of Peppered moth, explain the action of natural selection. What do you call the above phenomenon?

  • 2)

    Darwin's finches and Australian marsupials are suitable examples of adaptive radiation – Justify the statement

  • 3)

    Who disproved Lamarck’s Theory of acquired characters? How?

  • 4)

    How does Mutation theory of De Vries differ from Lamarck and Darwin’s view in the origin of new species.

  • 5)

    Explain stabilizing, directional and disruptive selection with examples

12th Zoology - Immunology Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Differentiate between:
    Innate immunity and acquired immunity

  • 2)

    Differentiate between:
    Primary and secondary immune responses

  • 3)

    Differentiate between:
    Active and passive immunity

  • 4)

    Differentiate between:
    Humoral and CMI immunity

  • 5)

    Differentiate between:
    Autoimmune disease and Immunodeficiency disease

12th Botany - Economically Useful Plants and Entrepreneurial Botany Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Differentiate bio-medicines and botanical medicines.

  • 2)

    Write the origin and area of cultivation of green gram and red gram.

  • 3)

    What are millets? What are its types? Give example for each type.

  • 4)

    If a person drinks a cup of coffee daily it will help him for his health. Is this correct? If it is correct, list out the benefits.

  • 5)

    Enumerate the uses of turmeric

12th Botany - Plant Breeding Three Marks Questions - by Question Bank Software View & Read

  • 1)

    How Rhizobium acts as an efficient bio- fertiIizer?

  • 2)

    Azolla increases the yield of paddy crop - support your answer.

  • 3)

    Mention any three advantages of Arbuscular mycorrhizal association.

  • 4)

    What makes the Trichoderma an effective bio-pesticide?

  • 5)

    Write a note on Green Manuring.

12th Botany - Environmental Issues Three Marks Questions - by Question Bank Software View & Read

  • 1)

    How do forests help in maintaining the climate?

  • 2)

    How do sacred groves help in the conservation of biodiversity?

  • 3)

    Which one gas is most abundant out of the four commonest greenhouse gases? Discuss the effect of this gas on the growth of plants?

  • 4)

    List out the effects of global warming.

  • 5)

    Mention any three sources of carbon dioxide emission.

12th Botany - Ecosystem Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Construct the food chain with the following data.
    Hawk, plants, frog, snake, grasshopper.

  • 2)

    Name of the food chain which is generally present in all type of ecosystem. Explain and write their significance.

  • 3)

    Shape of pyramid in a particular ecosystem is always different in shape. Explain with example.

  • 4)

    Generally human activities are against to the ecosystem, where as a student how will you help to protect ecosystem?

  • 5)

    Explain Grazing food chain with example.

12th Botany - Principles of Ecology Three Marks Quesions - by Question Bank Software View & Read

  • 1)

    Lichen is considered as a good example of obligate mutualism. Explain.

  • 2)

    What is mutualism? Mention any two example where the organisms involved are commercially exploited in modern agriculture.

  • 3)

    List any two adaptive features evolved in parasites enabling them to live successfully on their host?

  • 4)

    Mention any two significant roles of predation plays in nature.

  • 5)

    How does an orchid ophrys ensures its pollination by bees ?

12th Botany - Plant Tissue Culture Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Give the examples for micro propagation performed plants .

  • 2)

    Explain the basic concepts involved in plant tissue culture

  • 3)

    Based on the material used, how will you classify the culture technology? Explain it.

  • 4)

    Mention any three macronutrients and micro nutrients used in MS medium.

  • 5)

    What are the optimal conditions that favours the induction of callus from nutrient medium?

12th Botany - Principles and Processes of Biotechnology Three Marks Questions - by Question Bank Software View & Read

  • 1)

    What do you know about the word pBR332?

  • 2)

    Mention the application of Biotechnology.

  • 3)

    What are restriction enzyme. Mention their type with role in Biotechnology.

  • 4)

    Is there any possibilities to transfer a suitable desirable gene to host plant without vector? Justify your answer.

  • 5)

    How will you identify a vector ?

12th Zoology - Human Health and Diseases Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Explain the structure of immunoglobulin with suitable diagram.

  • 2)

    What are the cells involved innate immune system.

  • 3)

    What is vaccine? What are its types?

  • 4)

    A person is infected by HIV. How will you diagnose for AIDS?

  • 5)

    Autoimmunity is a misdirected immune response. Justify.

12th Zoology - Microbes in Human Welfare Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Explain the role of cry-genes in genetically modified crops.

  • 2)

    Write the key features of organic farming.

  • 3)

    Justify the role of microbes as a bio-fertilizer

  • 4)

    What is 'activated sludge' in sewage treatment?

  • 5)

    UV is an ideal disinfectant for waste water. Give Reason

12th Zoology - Applications of Biotechnology Three Marks Questions - by Question Bank Software View & Read

  • 1)

    What are transgenic animals? Give examples

  • 2)

    If a person thinks he is infected with HIV, due to unprotected sex, and goes for a blood test. Do you think a test such as ELISA will help? If so why? If not, why?

  • 3)

    Explain how ADA deficiency can be corrected

  • 4)

    What are DNA vaccines?

  • 5)

    Differentiate between Somatic cell gene therapy and germline gene therapy

12th Zoology - Organisms and Population Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Give the diagnostic characters features of a Biome

  • 2)

    Classify the aquatic biomes of Earth.

  • 3)

    What are the ways by which organisms respond to abiotic factors?

  • 4)

    Classify the adaptive traits found in organisms

  • 5)

    Differentiate Natality and Mortality

12th Zoology - Biodiversity and its Conservation Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Extinction of a keystone species led to loss of biodiversity – Justify.

  • 2)

    Compare and Contrast the insitu and exsitu conservation. (or) What are the differences between in-situ and ex-situ conservation ?

  • 3)

    What are called endangered species? Explain with examples

  • 4)

    Why do we find a decrease in biodiversity distribution, if we move from the tropics towards the poles?

  • 5)

    What are the factors that drive habitat loss?

12th Zoology - Environmental Issues Three Marks Questions - by Question Bank Software View & Read

  • 1)

    What effect can fertilizer runoff have on an aquatic ecosystem?

  • 2)

    How can we control eutrophication?

  • 3)

    Why does ozone hole form over Antarctica?

  • 4)

    Mention the causes of enhanced use of ultraviolet radiation

  • 5)

    Discuss the role of women in protection and conservation of forests.

12th Botany - Asexual and Sexual Reproduction in Plants Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Discuss the importance of Modern methods in reproduction of plants.

  • 2)

    What is Cantharophily.

  • 3)

    List any two strategy adopted by bisexual flowers to prevent self-pollination.

  • 4)

    What is endothelium

  • 5)

    “The endosperm of angiosperm is different from gymnosperm”. Do you agree. Justify your answer.

12th Botany - Classical Genetics Three Marks Questions - by Question Bank Software View & Read

  • 1)

    What are multiple alleles?

  • 2)

    What are the reasons for Mendel’s successes in his breeding experiment?

  • 3)

    Explain the law of dominance in monohybrid cross.

  • 4)

    Differentiate incomplete dominance and codominance.

  • 5)

    What is meant by cytoplasmic inheritance

12th Botany - Chromosomal Basis of Inheritance Three Marks Questions - by Question Bank Software View & Read

  • 1)


    From the above figure identify the type of mutation and explain it.

  • 2)

    Write the salient features of Sutton and Boveri concept.

  • 3)

    Explain the mechanism of crossing over.

  • 4)

    Write the steps involved in molecular mechanism of DNA recombination with diagram.

  • 5)

    What are the salient features of the chromosomal theory of inheritance ?

12th Standard Biology - Zoology - Evolution Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    The first life on earth originated

  • 2)

    The phenomenon of “ Industrial Melanism” demonstrates

  • 3)

    Who proposed the Germplasm theory?

  • 4)

    Fossils are generally found in

  • 5)

    The golden age of reptiles was

12th Standard Biology - Zoology - Molecular Genetics Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Hershey and Chase experiment with bacteriophage showed that ______.

  • 2)

    What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

  • 3)

    The first codon to be deciphered was ______ which codes for ________.

  • 4)

    When lactose is present in the culture medium:

  • 5)

    One gene one enzyme hypothesis was proposed by Beadle and Tatum based on ________

12th Standard Biology - Zoology - Principles of Inheritance and Variation Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Haemophilia is more common in males because it is a ______.

  • 2)

    Three children of a family have blood groups A, AB and B. What could be the genotypes of their parents?

  • 3)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO x IAIB?

  • 4)

    What can be the blood group of offspring when both parents have AB blood group?

  • 5)

    XO type of sex determination and XY type of sex determination are examples of ______.

JUNE MONTHLY TEST - 2019 - by KRP Matriculation Hr Sec School View & Read

  • 1)

    Match the following

    I) External fertilization i) pollen grain
    II) Androecium ii) anther wall
    III) Male gametophyte iii) algae
    IV) Primary parietal layer iv) stamens
  • 2)

    Identify the incorrect pair

  • 3)

    Assertion(A) : Sporopollenin preserves pollen in fossil deposits
    Reason (R): Sporopollenin is resistant to physical and biological decomposition

  • 4)

    Consider the following statement(s)
    i) In Protandrous flowers pistil matures earlier
    ii) In Protogynous flowers pistil matures earlier
    iii) Herkogamy is noticed in unisexual flowers
    iv) Distyly is present in Primula

  • 5)

    In Mendel’s experiments with garden pea, round seed shape (RR) was dominant over wrinkled seeds (rr), yellow cotyledon (YY) was dominant over green cotyledon (yy). What are the expected phenotypes in the F2 generation of the cross RRYY x rryy?

12th Biology - Zoology - Reproductive Health Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    The approach which does not give the defined action of contraceptive is

  • 3)

    Read the given statements and select the correct option.
    Statement 1: Diaphragms, cervical caps and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

  • 4)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 5)

    In the year ______    india is expected to become the largest country in population size ______

12th Zoology - Molecular Genetics Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Distinguish between structural gene, regulatory gene and operator gene

  • 2)

    A low level of expression of lac operon occurs at all the windows for treatment of various genetic disorders. Justify the statement

  • 3)

    Why the human genome project is called a mega project?

  • 4)

    From their examination of the structure of DNA, What did Watson and Crick infer about the probable mechanism of DNA replication, coding capability and mutation?

  • 5)

    Why tRNA is called an adapter molecule?

12th Zoology - Principles of Inheritance and Variation Three Marks Questions - by Question Bank Software View & Read

  • 1)

    Differentiate Intersexes from Supersexes

  • 2)

    Explain the genetic basis of ABO blood grouping man.

  • 3)

    How is sex determined in human beings?

  • 4)

    What is male heterogamety?

  • 5)

    Give an account of genetic control of Rh factor.

12th Standard Zoology - Reproductive Health 3 Marks Questions - by Question Bank Software View & Read

  • 1)

    Expand the following
    a) ZIFT
    b) ICSI

  • 2)

    What are the strategies to be implemented in India to attain total reproductive health?

  • 3)

    Differentiate foeticide and infanticide

  • 4)

    Describe the major STDs and their symptoms.

  • 5)

    What is GIFT?

12th Standard Zoology - Human Reproduction 3 Marks Questions - by Question Bank Software View & Read

  • 1)

    What is inhibin? State its functions

  • 2)

    Mention the importance of the position of the testes in humans.

  • 3)

    What is the composition of semen?

  • 4)

    Name the hormones produced from the placenta during pregnancy.

  • 5)

    Define gametogenesis.

12th Zoology - Reproduction in Organisms Three Marks Questions - by Question Bank Software View & Read

  • 1)

    The unicellular organisms which reproduce by binary fission are considered immortal. Justify

  • 2)

    Why is the offspring formed by asexual reproduction referred as a clone?

  • 3)

    Why are the offsprings of oviparous animal at a greater risk as compared to offsprings of viviparous organisms?

  • 4)

    Give reasons for the following:
    (a) Some organisms like honey bees are called parthenogenetic animals
    (b) A male honey bee has 16 chromosomes where as its female has 32 chromosomes

  • 5)


    (i) Identify the Process
    (ii) Name the Organism

12th Botany - Asexual and Sexual Reproduction in Plants Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Mention the contribution of Hofmeister towards Embryology.

  • 2)

    What is layering?

  • 3)

    Distinguish mound layering and air layering.

  • 4)

    Explain the conventional methods adopted in vegetative propagation of higher plants.

  • 5)

    What are diaspores?

12th Botany - Classical Genetics Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Name the seven contrasting traits of Mendel.

  • 2)

    What is meant by true breeding or pure breeding lines / strain?

  • 3)

    Give the names of the scientists who rediscovered Mendelism

  • 4)

    What is back cross?

  • 5)

    Define Genetics.

12th Botany - Chromosomal Basis of Inheritance Two Marks Questions - by Question Bank Software View & Read

  • 1)

    When two different genes came from same parent they tend to remain together.
    i) What is the name of this phenomenon?
    ii) Draw the cross with suitable example.
    iii) Write the observed phenotypic ratio.

  • 2)

    If you cross dominant genotype PV/PV male Drosophila with double recessive female and obtain F1 hybrid. Now you cross F1 male with double recessive female.
    i) What type of linkage is seen?
    ii) Draw the cross with correct genotype.
    iii) What is the possible genotype in F2 generation?

  • 3)
    s.no gamete types Number of progenies
    1 ABC 349
    2 Abc 114
    3 abC 124
    4 AbC 5
    5 aBc 4
    6 aBC 116
    7 ABc 128
    8 abc 360

    i) What is the name of this test cross?
    ii) How will you construct gene mapping from the above given data?
    iii) Find out the correct order of genes.

  • 4)

    What is the difference between missense and nonsense mutation?

  • 5)

    What does the condition synteny refers to?

12th Botany - Principles and Processes of Biotechnology Two Marks Questions - by Question Bank Software View & Read

  • 1)

    How do you use the biotechnology in modern practice?

  • 2)

    What are the materials used to grow microorganism like Spirulina?

  • 3)

    You are working in a biotechnology lab with a becterium namely E.coli. How will you cut the nucleotide sequence? explain it.

  • 4)

    What are the enzymes you can used to cut terminal end and internal phospho di ester bond of nucleotide sequence?

  • 5)

    Name the chemicals used in gene transfer.

12th Standard Botany - Plant Tissue Culture Two Marks Questions - by Question Bank Software View & Read

  • 1)

    What is the name of the process given below? Write its 4 types.

  • 2)

    How will you avoid the growing of microbes in nutrient medium during culture process? What are the techniques used to remove the microbes?

  • 3)

    Write the various steps involved in cell suspension culture.

  • 4)

    What do you mean Embryoids? Write its application.

  • 5)

    Define sterilization.

12th Standard Botany - Principles of Ecology Two Marks Questions - by Question Bank Software View & Read

  • 1)

    What is ecological hierarchy? Name the levels of ecological hierarchy. 

  • 2)

    What are ecological equivalents? Give one example

  • 3)

    ‘Green algae are not likely to be found in the deepest strata of the ocean’. Give at least one reason.

  • 4)

    What is Albedo effect and write their effects?

  • 5)

    The organic horizon is generally absent from agricultural soils because tilling, e.g., plowing, buries organic matter. Why is an organic horizon generally absent in desert soils ?

Class 12th Botany - Ecosystem Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Productivity of profundal zone will be low. Why?

  • 2)

    Discuss the gross primary productivity is more efficient than net primary productivity.

  • 3)

    Pyramid of energy is always upright. Give reasons

  • 4)

    What will happen if all producers are removed from ecosystem?

  • 5)

    Mention any two climatic factors and edaphic factors of an ecosystem.

Class 12th Botany - Environmental Issues Two Marks Questions - by Question Bank Software View & Read

  • 1)

    What is ozone hole?

  • 2)

    Give four examples of plants cultivated in commercial agroforestry.

  • 3)

    Expand CCS. (or) What is CCS?

  • 4)

    Methane is one of a potent green house gas. Point out a few sources from where methane is generated.

  • 5)

    What is Dobson unit?

Class 12th Botany - Plant Breeding Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Differentiate between primary introduction from secondary introduction.

  • 2)

    How are microbial innoculants used to increase the soil fertility?

  • 3)

    What are bio-pesticides? Why they are considered better than synthetic pesticides?

  • 4)

    Define acclimatization.

  • 5)

    Who coined the term "pureline"? Define it.

12th Standard Botany - Economically Useful Plants and Entrepreneurial Botany Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Write the cosmetic uses of Aloe.

  • 2)

    What is pseudo cereal? Give an example.

  • 3)

    Discuss which wood is better for making furniture.

  • 4)

    A person got irritation while applying chemical dye. What would be your suggestion for alternative?

  • 5)

    Name the humors that are responsible for the health of human beings.

12th Standard Zoology - Immunology Two Marks Questions - by Question Bank Software View & Read

  • 1)

    How does immune system work?

  • 2)

    What are interferons? Mention their role.

  • 3)

    List out chemical alarm signals produced during inflammation.

  • 4)

    Define acquired immunity.

  • 5)

    What is MALT and BALT?

12th Standard Zoology - Environmental Issues Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Expand
    (i) CFC
    (ii) AQI
    (iii) PAN

  • 2)

    What is SMOG and how it is harmful for us?

  • 3)

    List all the wastes that you generate, at home, school or during your trips to other places. Could you very easily reduce the generation of these wastes? Which would be difficult or rather impossible to reduce?

  • 4)

    Discuss the causes and effects of global warming. What measures need to be taken to control global warming?

  • 5)

    What would Earth be like without the greenhouse effect?

12th Standard Zoology - Organisms and Population Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Define ecological niche.

  • 2)

    What is Zero Stress?

  • 3)

    What is soil permeability?

  • 4)

    State Allen's rule.

  • 5)

    Mention the important behavioural adaptations seen is animals

12th Standard Zoology - Biodiversity and its Conservation Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Define endemism

  • 2)

    How many hotspots are there in India? Name them

  • 3)

    What are the three levels of biodiversity?

  • 4)

    Name the active chemical found in the medicinal plant Rauwolfia vomitoria. What type of diversity it belongs to?

  • 5)

    “Amazon forest is considered to be the lungs of the planet”- Justify this statement.

12th Standard Zoology - Applications of Biotechnology Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Mention the number of primers required in each cycle of PCR. Write the role of primers and DNA polymerase in PCR. Name the source organism of the DNA polymerase used in PCR.

  • 2)

    How is the amplification of a gene sample of interest carried out using PCR?

  • 3)

    What is genetically engineered Insulin?

  • 4)

    Explain how “Rosie” is different from a normal cow

  • 5)

    How was Insulin obtained before the advent of rDNA technology? What were the problems encountered?

12th Standard Zoology - Microbes in Human Welfare Two Marks Questions - by Question Bank Software View & Read

  • 1)

    How is milk converted into curd? Explain the process of curd formation

  • 2)

    Give any two bioactive molecules produced by microbes and state their uses.

  • 3)

    What is biological oxygen demand?

  • 4)

    What is antibiotic resistance?

  • 5)

    What is superbugt?

12th Standard Biology - Zoology - Human Reproduction Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    The mature sperms are stored in the ____.

  • 2)

    The male homologue of the female clitoris is ______.

  • 3)

    The most important hormone in intiating and maintaining lactation after birth is ______.

  • 4)

    Colostrum is rich in ______.

  • 5)

    _____ are endocrine cells.

12th Standard Biology - Zoology - Reproduction in Organisms Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Animals giving birth to young ones:

  • 3)

    In which mode of reproduction variations are seen _____.

  • 4)

    If the entire organism behaves as a gamete the Phenomenon is called _____

  • 5)

    ______ is a seasonal breeder.

12th Biology Quarterly Exam Question Paper 2019 - by Question Bank Software View & Read

12th Biology - Term 1 Model Question Paper - by Antoney - Tiruppur View & Read

  • 1)

    Animals giving birth to young ones:

  • 2)

    The most important hormone in intiating and maintaining lactation after birth is ______.

  • 3)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 4)

    Down's syndrome is a genetic disorder which is caused by the presence of an extra chromosome number _____.

  • 5)

    The total number of nitrogenous bases in human genome is estimated to be about _____.

12th Zoology - Human Health and Diseases Two Marks Question - by Question Bank Software View & Read

  • 1)

    Given below are some human organs. Identify one primary and one secondary lymphoid organ. Explain its role. Liver, thymus, stomach, thyroid, tonsils.

  • 2)

    What are interferons? Mention their role.

  • 3)

    List out chemical alarm signals produced during inflammation.

  • 4)

    Explain the process of replication of retrovirus after it gains entry into the human body.

  • 5)

    Name the causal agent of African sleeping sickness and the vector.

12th Standard Zoology - Evolution Two Marks Question - by Question Bank Software View & Read

  • 1)

    List out the major gases seems to be found in the primitive earth.

  • 2)

    Explain the three major categories in which fossilization occur?

  • 3)

    Explain how mutations, natural selection and genetic drift affect Hardy Weinberg equilibrium.

  • 4)

    How did Darwin explain fitness of organisms?

  • 5)

    Mention the main objections to Darwinism.

12th Standard Zoology - Molecular Genetics Two Marks Question - by Question Bank Software View & Read

  • 1)

    Give reasons: ‘Genetic code is universal’.

  • 2)

    Name the parts marked ‘A’ and ‘B’ in the given transcription unit:

  • 3)

    Mention any two ways in which single nucleotide polymorphism (SNPs) identified in human genome can bring revolutionary change in biological and medical science.

  • 4)

    State any three goals of the human genome project.

  • 5)

    Why is the term nucleic acid used for DNA and RNA?

12th Zoology - Principles of Inheritance and Variation Two Marks Question - by Question Bank Software View & Read

  • 1)

    What is haplodiploidy?

  • 2)

    What is Lyonisation?

  • 3)

    What is criss-cross inheritance?

  • 4)

    Why are sex linked recessive characters more common in the male human beings?

  • 5)

    What are holandric genes?

12th Zoology - Reproductive Health Two Marks Questions - by Question Bank Software View & Read

  • 1)

    What is amniocentesis? Why a statutory ban is imposed on this technique?

  • 2)

    Select the correct term from the bracket and complete the given branching tree

    (Barriers, Lactational amenorrhoea, CuT, Tubectomy)

  • 3)

    Correct the following statements
    a) Transfer of an ovum collected from donor into the fallopian tube is called ZIFT.
    b) Transfering of an embryo with more than 8 blastomeres into uterus is called GIFT.
    c) Multiload 375 is a hormone releasing IUD.

  • 4)

    Which method do you suggest the couple to have a baby, if the male partner fails to inseminate the female or due to very low sperm count in the ejaculate?

  • 5)

    Which type of women are benefited by Invitro fertilization?

12th Zoology - Human Reproduction Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Mention the differences between spermiogenesis and spermatogenesis

  • 2)

    Expand the acronyms
    a. FSH
    b. LH
    c. hCG
    d. hPL

  • 3)

    How is polyspermy avoided in humans?

  • 4)

    What is colostrum? Write its significance.

  • 5)

    Draw a labeled sketch of a spermatozoan.

12th Zoology - Reproduction in Organisms Two Marks Questions - by Question Bank Software View & Read

  • 1)

    Name an organism where cell division is itself a mode of reproduction.

  • 2)

    Name the phenomenon where the female gamete directly develops into a new organism with an avian example.

  • 3)

    What is parthenogenesis? Give two examples from animals.

  • 4)

    Which type of reproduction is effective -Asexual or sexual and why?

  • 5)

    What is plasmotomy?

12th Biology - Term 1 Five Mark Model Question Paper - by Question Bank Software View & Read

  • 1)

    What is the difference between syngamy and fertilization?

  • 2)

    Identify the given image and label its parts marked as a, b, c and d

  • 3)

    Write the preventive measures of STDs.

  • 4)

    Explain the inheritance of sex linked characters in human being.

  • 5)

    List the common withdrawal symptoms of drugs and alcohol abuse.

12th Biology Quarterly Model Question Paper - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    During favourable conditions ______ shows multiple fission.

  • 3)

    The foetal membrane that forms the basis of the umbilical cord is _____.

  • 4)

    A contraceptive pill prevents ovulation by ______.

  • 5)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO x IAIB?

12th Zoology - Immunology Book Back Questions - by Question Bank Software View & Read

  • 1)

    AIDS virus has

  • 2)

    All are peripheral lymphoid organs except

  • 3)

    In agglutination and precipitation reactions, the antigen is a ______ and ______ respectively

  • 4)

    B cells that produce and release large amounts of antibody are called

  • 5)

    Raja is injured and got swelling. The swelling is due to the infection of tissue is an example of

12th Botany - Economically Useful Plants and Entrepreneurial Botany Book Back Questions - by Question Bank Software View & Read

  • 1)

    Consider the following statements and choose the right option.
    i) Cereals are members of grass family.
    ii) Most of the food grains come from monocotyledon.

  • 2)

    Tamarindus indica is indigenous to _____.

  • 3)

    New world species of cotton _____.

  • 4)

    Observe the following statements and pick out the right option from the following:
    Statement I – Perfumes are manufactured from essential oils.
    Statement II – Essential oils are formed at different parts of the plants.

  • 5)

    Which one of the following matches is correct?

12th Standard Botany - Ecosystem Book Back Questions - by Question Bank Software View & Read

  • 1)

    Profundal zone is predominated by heterotrophs in a pond ecosystem, because of ______.

  • 2)

    Solar energy used by green plants for photosynthesis is only ______.

  • 3)

    Which of the following ecosystem has the highest primary productivity?

  • 4)

    Which one is in descending order of a food chain?

  • 5)

    Significance of food web is / are ______.

TN 12th Standard Biology Official Model Question Paper 2019 - 2020 - by Question Bank Software View & Read

12th Botany - Plant Breeding Book Back Questions - by Question Bank Software View & Read

  • 1)

    Pick out the odd pair

  • 2)

    Match Column I with Column II

    Column I Column II
    i) William S. Gaud I) Heterosis
    ii) Shull II) Mutation breeding
    iii) Cotton Mather III) Green revolution
    iv) Muller and Stadler IV) Natural hybridization
  • 3)

    The quickest method of plant breeding is _______.

  • 4)

    Desired improved variety of economically useful crops are raised by _______.

  • 5)

    Plants having similar genotypes produced by plant breeding are called _____.

12th Botany - Environmental Issues Book Back Questions - by Question Bank Software View & Read

  • 1)

    Which of the following would most likely help to slow down the greenhouse effect.

  • 2)

    Deforestation means ______.

  • 3)

    The unit for measuring ozone thickness _____.

  • 4)

    People’s movement for the protection of environment in Sirsi of Karnataka is ______.

  • 5)

    The plants which are grown in silivpasture system are ______.

12th Standard Botany - Principles of Ecology Book Back Questions - by Question Bank Software View & Read

  • 1)

    In soil water available for plants is ____.

  • 2)

    Read the following statements and fill up the blanks with correct option.
    i) Total soil water content in soil is called ______
    ii) Soil water not available to plants is called _______
    iii) Soil water available to plants is called _____.

  • 3)

    Pedogenesis refers to _____.

  • 4)

    Mycorrhiza promotes plant growth by _______.

  • 5)

    In a fresh water environment like pond, rooted autotrophs are ______.

Botany - Plant Breeding Zoology - Environmental Issues Book Back Questions - by Question Bank Software View & Read

  • 1)

    Right to Clean Water is a fundamental right, under the Indian Constitution

  • 2)

    As per 2017 statistics, the highest per capita emitter of Carbon dioxide in the world is

  • 3)

    The use of microorganism metabolism to remove pollutants such as oil spills in the water bodies is known as

  • 4)

    The Ozone Day is observed every year on September 16 as on this day in 1987 the ___________was signed for launching efforts to arrest the depletion of the fragile ozone layer in the stratosphere that prevents the harmful ultra-violet rays of the sun from reaching the earth. Fill the correct word in blank.

  • 5)

    Which among the following always decreases in a Food chain across tropic levels?

12th Zoology - Biodiversity and its Conservation Book Back Questions - by Question Bank Software View & Read

  • 1)

    Which of the following region has maximum biodiversity

  • 2)

    The organization which published the red list of species is

  • 3)

    Who introduced the term biodiversity?

  • 4)

    Which of the following forests is known as the lungs of the planet earth?

  • 5)

    Which one of the following are at high risk extinction due to habitat destruction?

12th Standard Zoology - Organisms and Population Book Back Questions - by Question Bank Software View & Read

  • 1)

    All populations in a given physical area are defined as

  • 2)

    Organisms which can survive a wide range of temperatuer are called

  • 3)

    Which of the following is an r-species

  • 4)

    The relationship between sucker fish and shark is__________

  • 5)

    Animals that can move from fresh water to sea called as______

12th Zoology - Applications of Biotechnology Book Back Questions - by Question Bank Software View & Read

  • 1)

    Dolly, the sheep was obtained by a technique known as

  • 2)

    How many amino acids are arranged in the two chains of Insulin

  • 3)

    PCR proceeds in three distinct steps governed by temperature, they are in order of

  • 4)

    ELISA is mainly used for

  • 5)

    Recombinant Factor VIII is produced in the ______ cells of the Chinese Hamster

12th Standard Zoology - Microbes in Human Welfare Book Back Questions - by Question Bank Software View & Read

  • 1)

    Cyclosporin – A is an immunosuppressive drug produced from _______

  • 2)

    Which of the following bacteria is used extensively as a bio-pesticide?

  • 3)

    Which of the following is not involved in nitrogen fixation?

  • 4)

    The purpose of biological treatment of waste water is to _______

  • 5)

    The gases produced in anaerobic sludge digesters are

12th Zoology - Human Health and Diseases Book Back Questions - by Question Bank Software View & Read

  • 1)

    A 30 year old woman has bleedy diarrhoea for the past 14 hours, which one of the following organisms is likely to cause this illness?

  • 2)

    Cirrhosis of liver is caused by chronic intake of ______

  • 3)

    The sporozoite of the malarial parasite is present in ______

  • 4)

    Spread of cancerous cells to distant sites is termed as

  • 5)

    AIDS virus has

12th Standard Zoology - Evolution Book Back Questions - by Question Bank Software View & Read

  • 1)

    The first life on earth originated

  • 2)

    Which of the following was the contribution of Hugo de Vries?

  • 3)

    Fossils are generally found in

  • 4)

    Which period was called “Age of fishes”?

  • 5)

    The Neanderthal man had the brain capacity of

12th Botany - Plant Tissue Culture Book Back Questions - by Question Bank Software View & Read

  • 1)

    The time duration for sterilization process by using autoclave is ______ minutes and the temperature is ______.

  • 2)

    Which of the following statement is correct

  • 3)

    The prevention of large scale loss of biological interity ____.

  • 4)

    Cryopreservation means it is a process to preserve plant cells, tissues or organs _____.

  • 5)

    Solidifying agent used in plant tissue culture is _____.

12th Zoology - Molecular Genetics Book Back Questions - by Question Bank Software View & Read

  • 1)

    Hershey and Chase experiment with bacteriophage showed that ______.

  • 2)

    What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

  • 3)

    Which of the following is the correct sequence of event with reference to the central dogma?

  • 4)

    Which of the following statements about DNA replication is not correct?

  • 5)

    Meselson and Stahl’s experiment proved

12th Botany - Principles and Processes of Biotechnology Book Back Questions - by Question Bank Software View & Read

  • 1)

    Restriction enzymes are _____.

  • 2)

    The process of recombinant DNA technology has the following steps
    I. amplication of the gene
    II. Insertion of recombinant DNA into the host cells
    III. Cutting of DNA at specific location using restriction enzyme .
    IV. Isolation of genetic material (DNA) Pick out the correct sequence of step for recombinant DNA technology.

  • 3)

    pBR 322, BR stands for ______.

  • 4)

    Which of the following one is used as a Biosensors?

  • 5)

    Assertion (A): Agrobacterium tumifaciens is popular in genetic engineering because this bacterium is associated with the root nodules of all cereals and pulse crops
    Reason(R): A gene incorporated in the bacterial chromosomal genome gets automatically transferred to the cross with which bacterium is associated.

12th Standard Zoology - Principles of Inheritance and Variation Book Back Questions - by Question Bank Software View & Read

  • 1)

    Haemophilia is more common in males because it is a ______.

  • 2)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO x IAIB?

  • 3)

    What can be the blood group of offspring when both parents have AB blood group?

  • 4)

    If the childs blood group is ‘O’ and fathers blood group is ‘A’ and mother’s blood group is ‘B’ the genotype of the parents will be ______.

  • 5)

    XO type of sex determination and XY type of sex determination are examples of ______.

12th Standard Botany - Chromosomal Basis of Inheritance Book Back Questions - by Question Bank Software View & Read

  • 1)

    An allohexaploidy contains ______.

  • 2)

    The A and B genes are 10 cm apart on a chromosome. If an AB/ab heterozygote is testcrossed to ab/ab, how many of each progeny class would you expect out of 100 total progeny?

  • 3)

    Accurate mapping of genes can be done by three point test cross because increases _____.

  • 4)

    If haploid number in a cell is 18. The double monosomic and trisomic number will be _____.

  • 5)

    Changing the codon AGC to AGA represents _______.

12th Standard Zoology - Reproductive Health Book Back Questions - by Question Bank Software View & Read

  • 1)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 2)

    A contraceptive pill prevents ovulation by ______.

  • 3)

    The approach which does not give the defined action of contraceptive is

  • 4)

    Read the given statements and select the correct option.
    Statement 1: Diaphragms, cervical caps and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

  • 5)

    Match column I with column II and select the correct option from the codes given below.

    Column I Column II
    A. Copper releasing IUD (i) LNG-20
    B. Hormone releasing (ii) Lippes loop IUD
    C. Non medicated IUD (iii) Saheli
    D. Mini pills (iv) Multiload-375

12th Standard Zoology - Human Reproduction Book Back Questions - by Question Bank Software View & Read

  • 1)

    The mature sperms are stored in the ____.

  • 2)

    The glandular accessory organ which produces the largest proportion of semen is ______.

  • 3)

    The most important hormone in intiating and maintaining lactation after birth is ______.

  • 4)

    The process which the sperm undergoes before penetrating the ovum is _____.

  • 5)

    The milk secreted by the mammary glands soon after child birth is called ______.

12th Standard Botany - Classical Genetics Book Back Questions - by Question Bank Software View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in _____.

  • 2)

    In Mendel’s experiments with garden pea, round seed shape (RR) was dominant over wrinkled seeds (rr), yellow cotyledon (YY) was dominant over green cotyledon (yy). What are the expected phenotypes in the F2 generation of the cross RRYY x rryy?

  • 3)

    Test cross involves ____.

  • 4)

    Select the correct statement from the ones given below with respect to dihydrid cross.

  • 5)

    Which Mendelian idea is depicted by a cross in which the F1 generation resembles both the parents.

12th Standard Botany - Asexual and Sexual Reproduction in Plants Book Back Questions - by Question Bank Software View & Read

  • 1)

    Choose the correct statement from the following

  • 2)

    Identify the correctly matched pair.

  • 3)

    Arrange the layers of anther wall from locus to periphery

  • 4)

    Assertion(A) : Sporopollenin preserves pollen in fossil deposits
    Reason (R): Sporopollenin is resistant to physical and biological decomposition

  • 5)

    Transmitting tissue is found in ______.

12th Standard Zoology - Reproduction in Organisms Book Back Questions - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Animals giving birth to young ones:

  • 3)

    The mode of sexual reproduction in bacteria is by ______.

  • 4)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A): Offsprings produced by asexual reproduction are genetically identical to the parent.
    Reason(R): Asexual reproduction involves only mitosis and no meiosis.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 5)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

12th Standard Botany - Classical Genetics One Mark Question and Answer - by Question Bank Software View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in _____.

  • 2)

    In order to find out the different types of gametes produced by a pea plant having the genotype AaBb, it should be crossed to a plant with the genotype _____.

  • 3)

    How many different kinds of gametes will be produced by a plant having the genotype AABbCC?

  • 4)

    How many characters studied by Mendel in pisum sativum

  • 5)

    Mendel's work were rediscovered by__________

12th Standard Botany - Asexual and Sexual Reproduction in Plants One Mark Question with Answer Key - by Question Bank Software View & Read

  • 1)

    Choose the correct statement from the following

  • 2)

    An eminent Indian embryologist is ______.

  • 3)

    Identify the correctly matched pair.

  • 4)

    Name the person who discovered the pollen tube?

  • 5)

    Cleavage polyembryony is noticed in _________________

12th Zoology - Human Health and Diseases One Mark Question with Answer - by Question Bank Software View & Read

  • 1)

    A 30 year old woman has bleedy diarrhoea for the past 14 hours, which one of the following organisms is likely to cause this illness?

  • 2)

    The sporozoites of Plasmodium vivax are formed from ________

  • 3)

    Spread of cancerous cells to distant sites is termed as

  • 4)

    Choose the symptom applicable for mumps

  • 5)

    ___________is a pandemic disease

12th Zoology - Principles of Inheritance and Variation One Mark Question and Answer - by Question Bank Software View & Read

  • 1)

    Haemophilia is more common in males because it is a ______.

  • 2)

    Which of the following phenotypes in the progeny are possible from the parental combination AxB?

  • 3)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO x IAIB?

  • 4)

    Which of the following is true about Rh factor in the offspring of a parental combination DdxDd (both Rh positive)?

  • 5)

    The ABO blood group was discovered by ________.

12th Zoology - Molecular Genetics One Mark Question with Answer Key - by Question Bank Software View & Read

  • 1)

    Hershey and Chase experiment with bacteriophage showed that ______.

  • 2)

    DNA and RNA are similar with respect to _____.

  • 3)

    What is the basis for the difference in the synthesis of the leading and lagging strand of DNA molecules?

  • 4)

    Chromosomes were first observed by ________.

  • 5)

    The term nucleic acid was coined by ________.

12th Standard Zoology - Evolution One Mark Question and Answer - by Question Bank Software View & Read

  • 1)

    The first life on earth originated

  • 2)

    Who published the book “Origin of species by Natural Selection” in 1859?

  • 3)

    Darwin’s finches are an excellent example of

  • 4)

    The age of fossils can be determined by

  • 5)

    The term biogenesis was coined by

12th Zoology - Reproductive Health One Mark Question and Answer - by Question Bank Software View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 3)

    The approach which does not give the defined action of contraceptive is

  • 4)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 5)

    Select the proper harmonal Composition of oral Contraceptive pills

12th Zoology - Human Reproduction One Mark Question Paper - by Question Bank Software View & Read

  • 1)

    The mature sperms are stored in the ____.

  • 2)

    The male sex hormone testosterone is secreted from _____.

  • 3)

    The site of embryo implantation is the _____.

  • 4)

    The foetal membrane that forms the basis of the umbilical cord is _____.

  • 5)

    The most important hormone in intiating and maintaining lactation after birth is ______.

12th Zoology - Reproduction in Organisms One Mark Question Paper - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The mode of sexual reproduction in bacteria is by ______.

  • 3)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 4)

    Transverse Binary fission is seen is ______

  • 5)

    In, dinoflagellates the types of asexual reproduction seen is _____

12th Botany - Principles and Processes of Biotechnology Model Questions Paper - by Question Bank Software View & Read

  • 1)

    Restriction enzymes are _____.

  • 2)

    Plasmids are ______.

  • 3)

    pBR 322, BR stands for ______.

  • 4)

    Which one of the following is not correct statement

  • 5)

    An analysis of chromosomal DNA using the southern hybridisation technique does not use _____.

12th Botany - Chromosomal Basis of Inheritance Model Question Paper - by Question Bank Software View & Read

  • 1)

    The A and B genes are 10 cm apart on a chromosome. If an AB/ab heterozygote is testcrossed to ab/ab, how many of each progeny class would you expect out of 100 total progeny?

  • 2)

    Due to incomplete linkage in maize, the ratio of parental and recombinants are ______.

  • 3)

    Changing the codon AGC to AGA represents _______.

  • 4)

    The following sequence represents the location of genes in a chromosome. A - B - C - M - R - S - y -Z. Which of the gene pairs will have least chance of getting inherited together?

  • 5)

    Identify the syntenic gene from the given genes sequence of a chromosome G-H-I-J-K-L-M-A-B

12th Botany - Classical Genetics Model Question Paper - by Question Bank Software View & Read

  • 1)

    Extra nuclear inheritance is a consequence of presence of genes in _____.

  • 2)

    In order to find out the different types of gametes produced by a pea plant having the genotype AaBb, it should be crossed to a plant with the genotype _____.

  • 3)

    The genotype of a plant showing the dominant phenotype can be determined by _____.

  • 4)

    The genes controlling the seven pea characters studied by Mendel are known to be located on how many different chromosomes?

  • 5)

    Among the following characters which one was not considered by Mendel in his experimentation pea?

12th Standard Botany - Asexual and Sexual Reproduction in Plants Important Question Paper - by Question Bank Software View & Read

  • 1)

    An eminent Indian embryologist is ______.

  • 2)

    Size of pollen grain in Myosotis ______.

  • 3)

    Assertion(A) : Sporopollenin preserves pollen in fossil deposits
    Reason (R): Sporopollenin is resistant to physical and biological decomposition

  • 4)

    Choose the correct statement(s) about tenuinucellate ovule.

  • 5)

    Which of the following represent megagametophyte?

12th Standard Zoology - Evolution Model Question Paper - by Question Bank Software View & Read

  • 1)

    The phenomenon of “ Industrial Melanism” demonstrates

  • 2)

    Who proposed the Germplasm theory?

  • 3)

    Modern man belongs to which period?

  • 4)

    The term biogenesis was coined by

  • 5)

    _____________ was not a part of theory of chemical evolution.

12th Standard Biology First Mid Term Model Questions Paper - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    The site of embryo implantation is the _____.

  • 3)

    Co-dominant blood group is ______.

  • 4)

    Assertion (A): Zea mays is a monocotyledonous plant.
    Reason (R): Shield shaped cotyledon is called scutellum.

  • 5)

    Assertion (A): DMH -11 is a transgenic mustard.
    Reason (R): It is developed by using bamase/ barstar technology.

12th Standard Biology Chapter 4 Principles of Inheritance and Variation Important Question Paper - by Question Bank Software View & Read

  • 1)

    Which of the following phenotypes in the progeny are possible from the parental combination AxB?

  • 2)

    Which of the following phenotypes is not possible in the progeny of the parental genotypic combination IAIO x IAIB?

  • 3)

    If the childs blood group is ‘O’ and fathers blood group is ‘A’ and mother’s blood group is ‘B’ the genotype of the parents will be ______.

  • 4)

    The inheritance of blood group is determined by multiple alleles as discovered by _________.

  • 5)

    The__________ is called null allele.

12th Standard Zoology - Reproductive Health Important Question Paper - by Question Bank Software View & Read

  • 1)

    Which of the following is correct regarding HIV, hepatitis B, gonorrhoea and trichomoniasis?

  • 2)

    Which one of the following groups includes sexually transmitted diseases caused by bacteria only?

  • 3)

    Read the given statements and select the correct option.
    Statement 1: Diaphragms, cervical caps and vaults are made of rubber and are inserted into the female reproductive tract to cover the cervix before coitus.
    Statement 2: They are chemical barriers of conception and are reusable.

  • 4)

    Select the incorrect action of hormonal contraceptive pills from the following

  • 5)

    Select the proper harmonal Composition of oral Contraceptive pills

12th Standard Zoology - Human Reproduction Important Question Paper - by Question Bank Software View & Read

  • 1)

    The site of embryo implantation is the _____.

  • 2)

    The foetal membrane that forms the basis of the umbilical cord is _____.

  • 3)

    The most important hormone in intiating and maintaining lactation after birth is ______.

  • 4)

    Assertion (A): The acrosome of the Sperm cell contains Sperm lysin.
    Reason (R): Sperm lysin destroys the deformed Sperm cells.

  • 5)

    _____ are endocrine cells.

12th Bio Zoology - Lesson 1 Important Question Paper - by Question Bank Software View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Animals giving birth to young ones:

  • 3)

    Assertion and reasoning questions:
    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion: Viviparous animals give better protection to their off springs.
    Reason: They lay their eggs in the safe places of the environment.
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.

  • 4)

    During favourable conditions ______ shows multiple fission.

  • 5)

    Plasmotomy is observed in ________

Biology 12th standard english medium frequently asked one mark questions - by Kavitha View & Read

  • 1)

    The gravid proglottids are cut off from the parent body in ______

  • 2)

    Regeneration was first studied by _______

  • 3)

    Regeneration was first studied in _______

  • 4)

    Starfish shown ______ type of regeneration.

  • 5)

    The sexual union of young individuals produced immediately after the division of the parent Cell is called _____

creative multiple choice questions in 12th biology chapter one - by Kavitha View & Read

  • 1)

    Conjugation is seen in _____

  • 2)

    Paedogamy is the sexual union of _____

  • 3)

    ______ is a seasonal breeder.

  • 4)

    Technique used for cultivation of sponges is based on ______

  • 5)

    External fertilization is seen is ______

+2 english medium Important multiple choice questions in biology chapter one - by Kavitha View & Read

  • 1)

    In which type of parthenogenesis are only males produced?

  • 2)

    Animals giving birth to young ones:

  • 3)

    The mode of sexual reproduction in bacteria is by ______.

  • 4)

    In which mode of reproduction variations are seen _____.

  • 5)

    In each of the following questions there are two statements. One is assertion (A) and other is reasoning (R). Mark the correct answer as
    Assertion (A) : In bee society, all the members are diploid except drones.
    Reason (R) : Drones are produced by parthenogenesis
    Codes:
    A. If both A and R are true and R is correct explanation for A
    B. If both A and R are true but R is not the correct explanation for A
    C. If A is true but R is false
    D. If both A and R are false.